This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Error in running Trimmomatic software

Hi, I have Single End fastq file and it needs trimming. So, I use trimmomatic software for this purpose.based on trimmomatic tutorial I write below code for my .fastq file:

java -jar ~/CIRI_v2.0.6/Trimmomatic-0.36/trimmomatic-0.36.jar SE -phred33 sra_data_SRR1427482.fastq sra_data_SRR1427482 ILLUMINACLIP:TruSeq3-SE:2:30:10 LEADING:20 TRAILING:20 HEADCROP:13

but after run it in my Terminal, I see bellow mesage;

TrimmomaticSE: Started with arguments:
 -phred33  SRR1427482.fastq  SRR1427482 ILLUMINACLIP:TruSeq3-SE:2:30:10 LEADING:20 TRAILING:20 HEADCROP:13

Automatically using 1 threads

java.io.FileNotFoundException: /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/TruSeq3-SE (No such file or directory)
    at java.io.FileInputStream.open0(Native Method)
    at java.io.FileInputStream.open(FileInputStream.java:195)
    at java.io.FileInputStream.<init>(FileInputStream.java:138)
    at org.usadellab.trimmomatic.fasta.FastaParser.parse(FastaParser.java:54)
    at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.loadSequences(IlluminaClippingTrimmer.java:110)
    at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.makeIlluminaClippingTrimmer(IlluminaClippingTrimmer.java:71)
    at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:32)
    at org.usadellab.trimmomatic.Trimmomatic.createTrimmers(Trimmomatic.java:59)
    at org.usadellab.trimmomatic.TrimmomaticSE.run(TrimmomaticSE.java:303)
    at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:85)

and finally SRR1427482 will be generated but it doesn't work. because when I run FastQC on it, the FastQC software cant analysis it. I appreciate if any body share his/her comment with me. Best Regards, Mohammad

rna-seq software error
• 7,572 views • link
updated by GenoMax GenoMax • written by modarzi modarzi

2 answers

Hello,

the problem is clearly statet out in the first line of the error message:

java.io.FileNotFoundException: /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/TruSeq3-SE (No such file or directory)

You have to specify the correct path to the ILLUMINACLIP file.

fin swimmer

PS: Please use the possibility to format your code with the code button. That makes your post more readable.

• 0 views • link
written by finswimmer finswimmer

Trimmomatic is looking for the adapters file TruSeq3-SE at this location : /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/

And I presume that this file is where you installed Trimmomatics something like ~/Software/Trimmomatic/adapters

You need to specify the location of ~/Software/Trimmomatic/adapters in your command or copy this directory to your /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/

• 0 views • link
written by Bastien Hervé Bastien Hervé

Dear Bastien Hervé based on your advise, I edit my command based on below:

java -jar ~/CIRI_v2.0.6/Trimmomatic-0.36/trimmomatic-0.36.jar SE -phred33 sra_data_SRR1427482.fastq sra_data_SRR1427482 ILLUMINACLIP:~/CIRI_v2.0.6/Trimmomatic-0.36/adapters/TruSeq3-SE.fa:2:30:10 LEADING:20 TRAILING:20 HEADCROP:13

but again I receive again below message: java.io.FileNotFoundException: /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/~/CIRI_v2.0.6/Trimmomatic-0.36/adapters/TruSeq3-SE.fa (No such file or directory) at java.io.FileInputStream.open0(Native Method) at java.io.FileInputStream.open(FileInputStream.java:195) at java.io.FileInputStream.<init>(FileInputStream.java:138) at org.usadellab.trimmomatic.fasta.FastaParser.parse(FastaParser.java:54) at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.loadSequences(IlluminaClippingTrimmer.java:110) at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.makeIlluminaClippingTrimmer(IlluminaClippingTrimmer.java:71) at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:32) at org.usadellab.trimmomatic.Trimmomatic.createTrimmers(Trimmomatic.java:59) at org.usadellab.trimmomatic.TrimmomaticSE.run(TrimmomaticSE.java:303) at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:85)

I appreciate if you share your comment with me.

• 0 views • link
written by modarzi modarzi

Well ! We are agree that this path /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/~/CIRI_v2.0.6/Trimmomatic-0.36/adapters/TruSeq3-SE.fa does not exist.

I don't really get why Trimmomatic absolutly want to take the /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/ path first.

I didn't test it but I think that if you put this in your command you would be good : ILLUMINACLIP:../../Trimmomatic-0.36/adapters/TruSeq3-SE.fa:2:30:10

If your TruSeq3-SE.fa file exist in your ~/CIRI_v2.0.6/Trimmomatic-0.36/adapters/TruSeq3-SE.fa of course

I will try to demystified this tomorrow.

• 0 views • link
written by Bastien Hervé Bastien Hervé

ok, I copy all files in adapters folder and jar file in sample folder(fastq). the result show completely successfully in Trimmomatic software. but during analysis I receive bellow message:

Automatically using 4 threads
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Exception in thread "Thread-0" java.lang.StringIndexOutOfBoundsException: String index out of range: 0
    at java.lang.String.charAt(String.java:658)
    at org.usadellab.trimmomatic.fastq.FastqParser.parseOne(FastqParser.java:65)
    at org.usadellab.trimmomatic.fastq.FastqParser.next(FastqParser.java:179)
    at org.usadellab.trimmomatic.threading.ParserWorker.run(ParserWorker.java:42)
    at java.lang.Thread.run(Thread.java:748)
Input Reads: 47956000 Surviving: 46943435 (97.89%) Dropped: 1012565 (2.11%)
TrimmomaticSE: Completed successfully

as you see, I got successfully message but i have Java exception. could you please share your comment with me?

• 0 views • link
updated by GenoMax GenoMax • written by modarzi modarzi

I see in seqanswers.com and one the audience recommend fastQValidator. no I install this software and try to validate my .fastq file in its sample folder based on below command:

~/cirRNA/apps/fastQValidator/bin/fastQValidator sra_data_SRR1427482 testFile.txt

but I see below Error:

WARNING - Problems encountered parsing command line:

Command line parameter sra_data_SRR1427482 (#1) ignored Command line parameter testFile.txt (#2) ignored

ERROR: No filename specified. See below for usage help.

As you see its Error is filename but my file name is ok.

I appreciate if you share your comment with me.

• 1 views • link
written by modarzi modarzi

I can't really help you here, I don't know fastQValidator tool. I mean I never used it.

But as I can see in the wiki : https://genome.sph.umich.edu/wiki/FastQValidator

In Required Parameters part, you have :

--file : FastQ filename with path to be processed.

In your commande line you don't have --file, neither a fastq file

Isn't your fastq file sra_data_SRR1427482.fastq, I don't see it in your command line

• 1 views • link
written by Bastien Hervé Bastien Hervé

Log in to answer this question.

More posts like this