This is a test version of Biostars. For the public version, visit https://www.biostars.org.
cufflinks transcripts to ensemble or NCBI transcript

Hi Guys

I used gffread -w transcripts.fa -g /path/to/genome.fa transcripts.gtf

to get my transcripts in fasta format.

What I got is cufflinks ids because this is what is found in cufflinks transcripts.gtf: 

>CUFF.1.1 gene=CUFF.1
GTGACTGAACTCTTCACCCCAGTCTGTGGCTTTCCCGTTGCAGTGAGAGCCACGAGCCAAGGTGGGCACT
TGATGTCGGATCTCTTCAACAAGCTGGTCATGAGGCGCAAGGGCATCTCTGGGAAAGGACCTGGGGCTGG
TGAGGGGCCCGGAGGAGCCTTTGCCCGCGTGTCAGACTCCATCCCTCCTCTGCCGCCACCGCAGCAGCCA
CAGGCAGAGGAGGACGAGGACGACTGGGAATCGTAGGGGGCTCCATGACACCTTCCCCCCCAGACCCAGA

How I convert this to something like:

>ENST00000342066.7
CCAGCAGATCCCTGCGGCGTTCGCGAGGGT

or even NCBI codes, fine with me.

I need this to use lncscore to detect some novel lncRNA.

Thanks

rna-seq
• 2,192 views • link
updated by Biostar Biostar • written by Tania Tania

1 answer

Just download the cDNA sequences from from the Ensembl FTP site.

• 1 views • link
written by Emily Emily

I think this is not what I need. I need my cufflink assembled transcripts in Ensemble format or NCBI?

• 1 views • link
written by Tania Tania

Did you use the -G option and a known reference GTF file with Cufflinks at some point in this process?

• 1 views • link
written by GenoMax GenoMax

No, should I use that?

• 1 views • link
written by Tania Tania

From cufflinks manual:

-g/–GTF-guide <reference_annotation.(gtf gff)&gt;<="" p="">

Tells Cufflinks to use the supplied reference annotation a GFF file to guide RABT assembly. Reference transcripts will be tiled with faux-reads to provide additional information in assembly. Output will include all reference transcripts as well as any novel genes and isoforms that are assembled.

• 1 views • link
written by GenoMax GenoMax

Great, thanks genomax a lot, appreciated :)

• 1 views • link
written by Tania Tania

Log in to answer this question.

More posts like this