This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to use ART to simulate NGS data

Dear all,

I would like to use ART to simulate Illumina reads from selected sequences. I downloaded the binaries for Linux 64 bit and tried on a small genome (Human Papillomavirus, HPV). I followed the instruction included in the bundle but I did not get any results:

$ art_illumina -ss HS20 -i ./hpv.fa -o ./paired_end_sep -l 100 -f 10 -p -m 500 -s 10 -sp -sam

 ====================ART====================
           ART_Illumina (2008-2016)          
               Q Version 2.5.8 (June 7, 2016)       
             Contact: Weichun Huang <whduke@gmail.com> 
            -------------------------------------------

the file: ./hpv.fa can not be opened
$ ls  
hvp.fa              paired_end_sep1.aln       paired_end_sep.sam  paired_end_sep1.fq
$ head paired_end_sep1.fq

$ head paired_end_sep.sam

$

Could you tell me what went wrong?

Thank you.

PS: I contacted Weichun Huang but so far no answer.

software error sequencing genome
• 4,174 views • link
written by marongiu.luigi marongiu.luigi

the file: ./hpv.fa can not be opened

Isn't the error clear?

• 0 views • link
written by GenoMax GenoMax

not really, the file is in the folder, I can open it with cat or with an editor. Why art cannot?

• 0 views • link
written by marongiu.luigi marongiu.luigi

1 answer

I tested the ART 64-bit linux binary with HPV sequence ("NC_001591") with your command line above and had no problem getting the program to work.

@NC_001591.1-750/1
GTTTGGCCAGCCCATTGACCTGCAATGCTACGAGAATCTAAAAGCTGAAGCGCCAGCTGAACAAGAGTTGGAGGCAGAGGAGGAGCTTATCCAAGGCATC
+
0C(FAFFFHHAHHJJGJJJJJEJJJHIHGGHGJGJJFCJ=I'HHJEJJBGJJIGIHJ=JAFDGCHCB6D;?@;DE:HDH>FD&D@D86D3BACDD@:DBD
@NC_001591.1-748/1
ATGTTAAAATTATGAAGCTCCCTAAAGGTGTGGAATGGTCTTTTGGTAATTTTGATAAGCTTTAACATTCTGCTAACATACTAACGGTGCTTGCACTACT
+
@CC@FFFDHHFHFJHGIJJI-HJIGJIJJIBGFIHDGEHG=ICGIIIAGEIFIHJJFEJBJ7GCH3E>C'DDFEG@ADDDD@+DDDC>@CC?CFD>0(BB
@NC_001591.1-746/1
TACTAGTGGTTCTGGTGGTCAACCAATAGGTGGAGTTACACCAGTTGAAATAGAATTACAAGAACTTCCTAGCAGATATACTTTTGTAATAGAGGAACCT
+
0@CFADFFGHHGHBJE)I0JIJFHGJJHHGIHJ3GJFJJIJG(FHIHI<IFIGIJIGI=J7HDIHGG5EDGDHFEBBB&DEC;B&;(DE<DEDDDDDDD8
• 0 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this