Dear all,
I got the whole genome sequences of a papaya variety. And I downloaded the ref genome (Carica papaya) from NCBI (scaffold level assembly). When I check for the quality of my sequences, everything is fine except for the Sequence Length Distribution. When I run bowtie without trimming I got the following warning
warning skiping mate #1 read ..... because it was < 2 character long.
And the alignment results was
62674658 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
16140697 + 0 mapped (25.75% : N/A)
62674658 + 0 paired in sequencing
31337329 + 0 read1
31337329 + 0 read2
14389072 + 0 properly paired (22.96% : N/A)
When I run bowtie after trimming, I didnt get any warnings. The alignment percentage is same. But we expect more alignment percentage since my sample also belongs to the papaya variety.
Is there any problem with the reads? Carica papaya (reference genome) has only scaffold level assembly. not chromosomal level. Will that matter in the alignment? Ive pasted few lines from my reference fasta file.
>NW_019011177.1 Carica papaya cultivar SunUp chromosome LG1 unlocalized genomic scaffold, Papaya1.0, whole genome shotgun sequence
TAATAAGAACATAGAGTAATATAATTGTGTTGAAAATTTCAGTATGGAATGAAATGTTTGACAAGCTTTGATAGGGATGC..
gaaaaatattatcctATAAGTAATTATACAAATTGCCGCTTCATTTTAGTAATATATTTCTagttaatttacaaaattac
cATGGATTATGCtctcttaattttataatatatgctctcttttctcatattttgatattgtatttaatatatatgtataa
caagtccataattttattaaaaaaatcataatgaaTACTATAAGTAATTGGAGAGAAGTATGTGATAGTTGGAGAGAAGT
AGATTTGGACACGTTAGtagtagaaaaaataatttctaaacaaCAGTGCCATGTTAGCCGTTGAAATGGATGAGAAATGA
>NW_019011178.1 Carica papaya cultivar SunUp chromosome LG1 unlocalized genomic scaffold, Papaya1.0, whole genome shotgun sequence
CTAAATATCATGTTTGTCTATTTATATCTTTAACTTTGCAAATGTCTAAAGCACTCATGACAAATAGACTCTTAGAAGC
TGAAAGCGGCtttaaattaacattaatatCGAACTGCTTTGCACCTAAATCACACAACAAAACATCAAAATTTTGATGAT
TATTAAGCGGCAGATAGGCTTATCttgattgattatattttaGATACAAAAAAGCAGTTATTTGTGTCATAATTTTCATC
Is there any problem with my reference genome file? Or should i try any other alignment software? Could you please guide me in this? Base Statistics
`File type Conventional base calls
`Encoding Sanger / Illumina 1.9
Total Sequences 31337329
Sequences flagged as poor quality 0
Sequence length 0-151
%GC 36
Reference Genome Statistics
Assembly level: Scaffold
Assembly: GCA_000150535.1 Papaya1.0 scaffolds: 17,766 contigs: 47,485 N50: 10,650 L50: 7,081
BioProjects: PRJNA264084, PRJNA20267
Whole Genome Shotgun (WGS): INSDC: ABIM00000000.1
Statistics: total length (Mb): 370.419
protein count: 26103
GC%: 39.0069
0 answers
No answers yet.
Log in to answer this question.
It will be helpful if you can provide following information
Ive updated my post. Kindly check it. I have 17766 fasta headers in my file and total number of bases in my reference genome is 370418818
Hi Vijay, I tried with bwa mem. In that I got 55% alignment. How can I interpret this?