How to replace a stretch of a sequence with N's in a fasta file · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

How to replace a stretch of a sequence with N's in a fasta file

Hi! I´m trying to change a stretch of 300,000 nucleotides on chromosome 21, with NNN´s in a fasta file. This turned out to be not such a trivial task. I searched BioPython packages for a solution but can't find anything appropriate. It needs to a specific region between 8,202,082–8,552,360 nucleotides on chr 21. Any ideas?

fasta biopython

• 3,430 views • link

updated 8.4 years ago by h.mon

• written 8.4 years ago by Fluorine

1 answer

maskfasta from bedtools.

• 0 views • link

written 8.4 years ago by h.mon

That was a simple solution and it worked perfectly. I was overthinking how to solve it. Thank you!

• 0 views • link

written 8.4 years ago by Fluorine

Log in to answer this question.

More posts like this

Aggregation and analysis of MAF files
written 6.1 years ago by weisekyle •

Hello all, I have cancer genomic data (tumor/normal whole exome sequencing) from 50 patients that received the same type of treatment, half of whom responded. …
Extract a chromosome from a WIG file
written 7.9 years ago by Fluorine

I have a large WIG files which are difficult to run in IGV, due to the size. I am only interested in chromosome M so …
Strategies for identifying as many homologs as possible
written 8.2 years ago by michael •

I am working on a follow-up to a study done in 2006. In it, the authors attempted to identify "all homologs" of a gene (using …
Does bamtools split preserve sort and rmdup?
written 8.5 years ago by ccnn •

Taking over someone else's code, I've discovered a bottleneck. This is a portion of a script that accepts a BAM and outputs smaller, sorted, rmdup-ed, …
Editing headers from a vcf.gz file
written 8.7 years ago by ricfoz •

Hello everyone Do anyone know any tool or script to edit the header and add a "chr" prefix to the chromosome name header directly in …
getting a consense one header .fasta file from a genic region, from .bam template
written 8.7 years ago by ricfoz •

I started with a 9GB file of a human Xth chromosome with a .bam format, and I am trying to get a specific genic region …
How to center SNP position from a tag pair and add flanking sequence using reference genome
written 10.7 years ago by grmunjal •

<p>I have a fasta file containing tag pairs (63 identical nucleotides + 1 SNP) like so:</p> <pre> >TP2_query CAGCAAAAAAAAAAAAAAAAAAATG<strong>A</strong>AACTTCTGAGAGGGAAAAATTACTCAACCTTATATTCT >TP2_hit CAGCAAAAAAAAAAAAAAAAAAATG<strong>T</strong>AACTTCTGAGAGGGAAAAATTACTCAACCTTATATTCT</pre> <p>I would like to …
Python and SNP Databases, how?
written 12.0 years ago by R.Blues

Hello everyone, I am working on a Python script to process SNP data from several sequenced samples. An important part of this is querying the …
Making Annotated Chromosome Using Biopython
written 12.4 years ago by Janake

<p>I am trying to recreate the annotated chromosome using biopython (<a href='http://biopython.org/DIST/docs/tutorial/Tutorial.html#sec345'>http://biopython.org/DIST/docs/tutorial/Tutorial.html#sec345</a>). I have a test code that would create one chromosome and one annotated …
What Is A Good Strategy For Finding Common Bacterial Sequences In A Potentially Contaminated Human …
written 13.2 years ago by Dan D

<p>I typically work on the programming/data management side of things, but we're short-staffed and tricky analysis jobs sometimes work their way to me when others …