HI!
While running novel miRNA identification with sRNAbench on this file with parameters
dbPath=sRNAtoolboxDB input=/path_to_file/ERR187516.fastq.gz output=sRNAtoolboxDB/out/ERR187516_miR microRNA=hsa species=ucsc.hg19 p=4 adapter=TGGAATTCTCGGGTGCCAAGGAACTC adapterMinLength=6 adapterMM=1 minRC=2 mm=0 alignType=v predict=true
these warnings pop up:
WARNING: The results will be FALSE if these sequences are spliced!! hairpin
Is this just a general warning that says that hairpins that originate from intronic parts of the host gene during splicing can not be properly aligned? Or does it mean something completely different?
WARNING: The coordinates of the theoretical star sequence are out of range! (start < 1)null
This warning pops up 3 times with this files, but for different input files the number of occurrences is different. What does it mean exactly? And is it a problem that this pops up? Or is it just a reason it discards several reads which happens often?
Basically, I'm interested if it is a problem that I have these warnings, or are they a regular thing which pops up often?
Thanks,
Nikola
0 answers
No answers yet.
Log in to answer this question.