I am trying to put together a panel of oligo probes, and I am using primer3-py to design oligos to specific criteria and then ask if they are a good pair.
One way I am doing this is asking how much two oligos heterodimerize.
import primer3
primer3.calcHeterodimer('TCAACGTGGAATGTGCCCTGGTAGCAG', 'TGTTATGGTCCAGGAATGTGACATGGGTTG')
Which returns: ThermoResult(structure_found=True, tm=2.88, dg=-5405.87, dh=-47000.00, ds=-134.11). First I do not know how to interpret these results, nor do they seem to change even when I alter the input oligos like this:
primer3.calcHeterodimer('CAACGTGGAATGTGCCCTGGTAGCAGAA', 'TGTTATGGTCCAGGAATGTGACATGGGTTG')
1 answer
I'm not sure on what the tm value is saying, and the primer3 or primer3-py documentation doesn't really clear it up either, however I think it is saying that this structure will not form over 2.88C so it's not a worry. Hopefully if I'm wrong about the Tm someone will let you know. The rest of the output are the standard reaction calculations for primers, with the exception the web interfaces usually output in kcal/mol and it looks like primer3-py is just using cal/mol.
So for your output is figure from this equation ΔG = ΔH – TΔS
ThermoResult(structure_found=True, tm=2.88, dg=-5405.87, dh=-47000.00, ds=-134.11)
dg = deltaG, this is the Gibbs free energy, the energy required to break the secondary structure general guideline is the more positive a value the better and anything more positive than -9000cal or -9kcal is generally acceptable.
dh = deltaH, this is the enthalpy of the system
ds = deltaS, this is the entropy of the system
Along with the default temp (37 in this case) the dh and ds are used to figure your dg
from the primer3-py documentation
calcHeterodimer(seq1, seq2, mv_conc=50, dv_conc=0, dntp_conc=0.8, dna_conc=50, temp_c=37, max_loop=30)
Calculate the heterodimerization thermodynamics of two DNA sequences.
**Note that at least one of the two sequences must by <60 bp in length.**
This is a cap imposed by Primer3 as the longest reasonable sequence length
for which a two-state NN model produces reliable results (see
primer3/src/libnano/thal.h:50).
Args:
seq1 (str) : First DNA sequence to analyze for heterodimer
formation
seq2 (str) : Second DNA sequence to analyze for
heterodimer formation
mv_conc (float/int) : Monovalent cation conc. (mM)
dv_conc (float/int) : Divalent cation conc. (mM)
dntp_conc (float/int) : dNTP conc. (mM)
dna_conc (float/int) : DNA conc. (nM)
temp_c (int) : Simulation temperature for dG (Celsius)
max_loop(int) : Maximum size of loops in the structure
Returns:
A `ThermoResult` object with thermodynamic characteristics of the
heterodimer interaction.
Raises:
``RuntimeError``
I hope this helps
Sean
Log in to answer this question.