This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Fastq_quality_filter: found invalid nucleotide sequence

I am trying to filter reads(Illumina data - RNA-Seq) based on the quality of 30 using the fastx toolkit. But I got an error like this. fastq_quality_filter: found invalid nucleotide sequence (GCGGAGWAACCGTTCGGCEACCAGGTGGCATCGCCGCCGAGGGWGCTCCCGTGGCGCGGGCAGTCGTTGACGAACATCTC) on line 85766.

How to resolve this error?

Thanks in advance.

rna-seq assembly ngs
• 2,899 views • link
updated by Sej Modha Sej Modha • written by Sureshkumar V. • Sureshkumar V.

Sequence contains 'W' (and maybe other) character(s) that might be causing the error. You can try other tools such as fastqc.

• 0 views • link
written by Sej Modha Sej Modha

'W' should be an allowed character, since it encodes for the weak bases (A or T). I've never seen an 'E'; this might be the problem.

There are many recent alternatives to the quite old fastx tool-kit. Just to name a few: bbduk, trimgalore, or trimmomatic.

• 0 views • link
written by michael.ante michael.ante

How did you get ambiguous codes in your raw RNAseq data? What technology is this data from and has it been pre-processed in some fashion?

• 0 views • link
written by GenoMax GenoMax

1 answer

Your sequence seems to contain ambiguity codes. Simply remove those and you should be fine

• 0 views • link
written by egeulgen egeulgen

You can have a look at the ambiguity codes here

• 0 views • link
written by NB NB

Log in to answer this question.

More posts like this