How can i specify standalone blastn options for it to retrieve full query sequences in output?
For example i have a query lengths ~(100 - 300) bp, and i'm blasting one of them (i am doing 2 by 2 blast) against subject with length ~3000bp. But in the output i have a lot of hits that are very-very small, and i'm not interested in that
ex_chr2L_10459384_10459517_+_ cl_chr2L_10459280_10459880_+_2_s_apiMel3_0_659_+_659 88.235 17 2 0 69 85 512 528 0.029 21.4 ACAATGGGCGGTGATTT ACAATGGGAGGAGATTT ex_chr2L_10459384_10459517_+_ cl_chr2L_10459280_10459880_+_2_s_apiMel3_0_659_+_659 85.714 14 2 0 100 113 294 307 1.4 15.9 CTCAAGTTTACTAT CTCTAGTTTATTAT ex_chr2L_10459384_10459517_+_ cl_chr2L_10459280_10459880_+_2_s_apiMel3_0_659_+_659 79.167 24 3 2 50 73 328 349 1.4 15.9 CACCAACAATATCATTGTCACAAT CATCAA-AAT-TTATTCTCACAAT ex_chr2L_10459384_10459517_+_ cl_chr2L_10459280_10459880_+_2_s_apiMel3_0_659_+_659 100.000 7 0 0 109 115 31 37 4.9 14.0 ACTATAA ACTATAA ex_chr2L_10459384_10459517_+_ cl_chr2L_10459280_10459880_+_2_s_apiMel3_0_659_+_659 100.000 7 0 0 104 110 88 82 4.9 14.0 AGTTTAC AGTTTAC ex_chr2L_10459384_10459517_+_ cl_chr2L_10459280_10459880_+_2_s_apiMel3_0_659_+_659 100.000 7 0 0 64 70 151 157 4.9 14.0 TTGTCAC TTGTCAC ex_chr2L_10459384_10459517_+_ cl_chr2L_10459280_10459880_+_2_s_apiMel3_0_659_+_659 100.000 7 0 0 80 86 183 177 4.9 14.0 TGATTTT TGATTTT ex_chr2L_10459384_10459517_+_ cl_chr2L_10459280_10459880_+_2_s_apiMel3_0_659_+_659 100.000 7 0 0 107 113 268 262 4.9 14.0 TTACTAT
here is the command line options i use:
blastn -query query.fa -subject subject.fa -word_size=4 -outfmt="6 qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore qseq sseq" -out output.txt
This is a local FAQ:
Force blast to align the whole query read, How to force blastn to align full subject, How to show the entire query sequence in the alignment in NCBI stand-alone blastn, Is getting the full query read as output from Blast possible?, BLAST: do not cut off variable sequence start.