counts reads for miRNA mapped againt mirbase
Hello,
I aligned my miRNA-Seq againt mirbase by bowtie. I would like to count the reads aligned to each miRNA. is there any tools specific for this ?
Thanks
mirna-seq
• 2,776 views
•
link
written
by
jonessara770
25
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
miRNA Analysis
written by Pritesh 1Hello everyone, I am performing miRNA analysis on blood-based miRNA-seq data. My sequencing reads are 51 bp long, while the expected length of mature miRNAs …
-
command line for umi_tools count_tab
written by Luca 0Hi everyone, I'm dealing with smallRNA Seq. My reads have UMI, which I extracted and appended to the read name using `umi-tools`'s function `extract`. Then, …
-
Mouse miRNA mapping
written by AellSidious 0Hello everybody, I'm trying to map some mouse (mus musculus) miRNA reads on reference mature miRNA sequences from miRBase with Bowtie. Problem is that the …
-
help in my miRNA analysis
written by Claire 1**Hi Everyone** I am trying to detect miRNA in my miRNA samples. Just want to check I am following correct steps: 1. I downloaded mature.fa …
-
Is there any recommended steps/pipeline for identifying differential miRNA expression profile?
written by bioinforesearchquestions 38Hello friends, I have small RNA sequenced from bovine using Illumina platform. I would like to know what is the procedure for identifying differential miRNA …
-
best STAR options for miRNA mapping?
written by jonessara770 25Hello, I am a newbie in STAR. my questions: Do you use STAR for mapping miRNA? can you share the command lines that you use …
-
extract sequence around snp
written by jonessara770 25Hello, I would like to extract sequence around snp from the human genome like below. Is there any tools to do this? CTGCTGGCCGTGATGGCCTATGACC[A/G]CTTTGTGGCCATCTGTAACCCTTTG Thanks
-
How to align miRNA seq data to known miRNAs?
written by linaskunigenas 0Hello. I tried to align miRNA seq data to mirBase mature and hairpin RNAs with bowtie and bowtie2 and got very low alignment. I tried …
-
low % of read map to mirase mature miRNAs
written by prp291 7I have some small RNA-seq data and I want to predict the miRNA sequence. Genome sequences is available for my organism. After preprocessing like adapter …
-
Finding Isomirs In Alingnment Files. Next Steps After Mapping To The Pre-Mirnanome ?
written by Agatha 35<p>Hi, </p> <p>I am currently trying to find isoMiRS in Illumina RNA-seq libraries and I am currently stuck at the alignment step. I have aligned …
Since miRNA's are small your alignment should cover most of the length of the miRBase entry you could do
samtools view your.bamand then cut the third field out (which should be the name of miRBase miRNA) and count those hits.Previously discussed here