Hi

I am not sure if this is a truly stupid question but, so far I have mapped protein-RNA interactions at a single nucleotide resolution using CIMS/CITS analysis of CHIP-seq data. Now I just need to map my seed sequences that I am analyzing for to these mutation locations but I am not sure how to access the sequences from the filtered bed files at the end since this is at a single-nucleotide resolution. The filtered bed after CITS is of the format:

1 2236260 2236265 CITS_1[gene=1_f_c78][PH=3][PH0=0.07][P=9.77e-03] 3 +

And my seed sequence is essentially a list like: hsa-miR-335-3p UUUUUCAUUAUUGCUCCUGACC