Hi Folks,
I am working on miRNA sequenced reads using Illumina (51bp, single-end reads).
A - Sample
B - Total reads
C - Reads_with_adapter_sequences
D - Per_of_reads_with_adapters
A ----------- B ------------- C ------------ D
Sample1 - 6,272,535 - 5,804,066 - 92.53%
Sample2 - 4,800,241 - 4,056,219 - 84.50%
Sample3 - 5,960,008 - 4,600,023 - 77.18%
Sample4 - 5,012,012 - 4,064,122 - 81.08%
Sample5 - 4,870,812 - 4,064,926 - 83.45%
Sample6 - 3,635,435 - 3,145,228 - 86.51%
Is these percentage of reads with adapters sequenced reasonable for miRNA sequencing?
0 answers
No answers yet.
Log in to answer this question.
I'll answer with a question: How long are the miRs you are sequencing?
We sequenced 51 cycles. I checked for this adapter but only this sequence "TGGAATTC" in raw reads
You didn't get me. The miRs themselves.
I suspect they should be 20-25 bases long.
So you should expect the adapter to appear in all of the reads, shouldn't you?
Hi Asaf, yes I was expecting adapters to be part of my sequenced reads. But I want to know the percentage which I am getting is reasonable or low or high?
For example, as per this mirdeep2 tutorial page (https://drmirdeep.github.io/mirdeep2_tutorial.html), I pasted the contents for your reference
From mirdeep2 tutorial page: If the resulting number of sequences with an adapter is around 70% of the number of your input sequences the data set can be considered as reasonably good. Note: In case that only adapters have been sequenced predominantly you will also get a high number which is obviously not good. If you only get 10% of sequences with an adpater then likely something went wrong during the sequnecing library preparation or your sample doesn't contain too many small RNAs.
In my case, they are well above 70%. So I am confused a bit.
In this case having the particular RNA adapter is a good thing so you want that number to be as high as possible (practically it is unlikely to be 100%). You can look for that adapter and trim to the 3'-end. Reads with the adapater after trimming should be in the range of sizes you expect them to be.
Hi Genomax,
I did two different trimming just to see the trend using trimmomatic tool.
First case: trimmed this adapter "TGGAATTCTCGGGTGCCAAGG" and then retained the reads only between this range 18-25 (minimum read length is 18 bases and CROP is 25). Here, I could see two peaks one at 22 and another at 25.
Second case: trimmed this adapter "TGGAATTCTCGGGTGCCAAGG" and then retained the reads only between this range 18-35 (minimum read length is 18 bases and CROP is 35). Here, I could see three peaks one at 22, one at 33 and last one at 35.
In both the cases, I could see a huge number of reads at 25th and 35th position.
I could see the following trend