Question: blast alignemnt query coverage
0
Entering edit mode

Can anyone tell me the error in this command. I want to get full query coverage also with my seq. alignment and when I am using qcovs it is showing error.

blastn -db 17978_old_complete_genome -query 17978new_ol_genes.fasta -perc_identity 90 -evalue 0.0001 -qcovs -outfmt 6  > complete_genome_0.0001_oneline_output_qcovs
ADD COMMENTlink 2.4 years ago sharmatina189059 • 30 • updated 2.4 years ago geek_y 9.7k
Entering edit mode
1

Why don't you state the error that you are getting while running the command

ADD REPLYlink 2.4 years ago
Karma
• 200
Entering edit mode
1

The pattern of somehow receiving upvotes for trivial comments continues into your new account, Mask/snijesh. If you're encouraging your colleagues to do this, as you mentioned in your previous comments, please do not do that. If not, I direct this message to the OP sharmatina189059 and ask them to use upvotes with caution and award them to posts that contribute significantly to the subject matter at hand.

ADD REPLYlink 2.4 years ago
RamRS
21k
Entering edit mode
0

I am not sure what you are worried about. I did not tell anyone to upvote my comments.

ADD REPLYlink 2.4 years ago
Karma
• 200
Entering edit mode
0

Not to debate semantics, but I'm not "worried" about anything.

You remarked on how Mask was your previous account (See: C: RNA-Seq or Exome Seq for Clinical data analysis ). Using the older account, you also said you'd asked your colleagues to up-vote your comments. (See: C: Getting error in running GATK (GenomeAnalysisTK-3.7)? ), which we observed as odd owing to them being up-votes to relatively trivial comments.

Here, the pattern of receiving up-votes to trivial comments continues, so I asked you if your colleagues were still doing this, or if this were a one-off occurrence (a possibility I addressed with the comment directed to /u/sharmatina189059 ).

I hope this clears stuff up for you.

ADD REPLYlink 2.4 years ago
RamRS
21k
Entering edit mode
0

I am not using the account you mentioned and I don't know who upvoted my comments here.

ADD REPLYlink 2.4 years ago
Karma
• 200
Entering edit mode
0

Thank you for clearing that up. New users tend to upvote any response they get, so that might be the case here.

ADD REPLYlink 2.4 years ago
RamRS
21k
Entering edit mode
1

Just try the same command with quotes The command string needs these quotes, such that the command line looks like:

blastn -outfmt "6 qcovs" ...
ADD REPLYlink 2.4 years ago
Karma
• 200
Entering edit mode
0

Thanks ..it works but which coloumn gives query coverage

ADD REPLYlink 2.4 years ago
sharmatina189059
• 30
Entering edit mode
1

why don't you upload your results.. at-least first 10 lines

ADD REPLYlink 2.4 years ago
Karma
• 200
Entering edit mode
1

Output should be in the same order as what you specified in -outfmt 6 "sseqid qseq qcovs sseq" gives you

gi|672239066|ref|NR_125655.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT
gi|631253076|ref|NR_114274.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT
gi|636560310|ref|NR_116370.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT
gi|343198619|ref|NR_043083.1|   CTAAAAGTTACCCCACCGAC    2   CTAAAGGTTACCCCACCGAC
gi|343201461|ref|NR_042187.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT

Here qcovs is in column 3.

ADD REPLYlink 2.4 years ago
genomax
68k

Login before adding your answer.

Powered by the version 1.8