Working example for VCF visualization in Circos · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

Working example for VCF visualization in Circos

I would like to plot the SNP density of a genome plotted as histogram using Circos (http://circos.ca/), the inputs are a SNP variant calling VCF file and reference genome Genbank fasta file or Gbk file, I try to look for an example parameter for this plotting, but could not find exact solution. Would you please share with me if you have a working sample? Thank you!

snp next-gen

• 5,968 views • link

updated 8.5 years ago by ibseq12 •

• written 9.0 years ago by Charles Yin

hi genebow any more thoughts? did you manage to use circos for snp?

• 0 views • link

written 8.5 years ago by ibseq12 •

1 answer

I close this problem as I see the solution from Circos tutorial. The VCF file needs to be parsed as histogram file and the Circos uses this file for plotting.

The turorial is at here

Cheers!

• 0 views • link

written 9.0 years ago by Charles Yin

Thanks for sharing the solution, but there is no need to close the thread.

• 0 views • link

written 9.0 years ago by WouterDeCoster

Log in to answer this question.

More posts like this

SNP Density plot with custom genome using karyoploteR
written 1.8 years ago by adarsh •

Hi, I am trying to create an SNP Density plot from VCF file using a custom genome file. However when I am plotting the graph, …
How to visualize multiple bacterial genomes with circos?
written 2.5 years ago by marongiu.luigi

I am trying to use [circos][1] to visualize the alignment of multiple bacterial genomes (essentially to create a genome atlas like this: ![enter image description …
SNP density
written 3.9 years ago by Shin Taguchi •

Hi, everyone. I would like to create a figure plotting SNP density for each chromosome from a vcf file. All I have on hand now …
Convert nucleotide fasta of contigs to protein sequence genbank
written 6.7 years ago by claping •

I recently ran Prokka on a .fasta file of ordered contig DNA sequences. The file looks like this: >NODE_6_length_103505_cov_20.694918 agcgattagcccccagcgattagcgaaaagcgattttttattagcgattagcgattagcg attagcgattagcgattttagaactatttgcctaaatttctgcttaaatatctacagaaa The annotation went (fairly) …
snp density plot
written 6.8 years ago by evelyn

Hello, I have a `vcf` merge file with multiple samples including chromosome and position of `SNPs`. I want to plot the `SNP` density over separate …
convert fasta/gb to vcf
written 7.9 years ago by marongiu.luigi

Dear all, Would be possible to convert a fasta or genbank file into a variant calling file VCF or the only source is a GFF? …
can variants be called between two genomes?
written 8.1 years ago by Charles Yin

Usually, SNP calling is between a reference genome sequence (fasta) and reads (fastq), is it possible to use the commonly used pipeline (BWA alignment and …
SNP density plot
written 8.8 years ago by krp0001 •

Hello, all, I am working on SNP studies on fungus. I have over 1million snps and i have denovo assembled reference genome of 45Mb. I …
How to validate zero SNPs in variant calling?
written 8.9 years ago by Charles Yin

I want to compare two bacterial genomes using SNP signature. The method uses one bacterial genome as reference and aligns the reads from other bacterial …
Plot gene density and SNPs one below the other as multiple plots in the same graph
written 11.1 years ago by sonalgupta802 •

I want to plot the gene density for which I have made a file of type 0.0-0.5Mb - No of genes 0.5-1.0Mb - No. of …