This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Why is there a star in some primer sequences (library preparation)

In the Adapterama paper, they are talking about a way to tag individuals within a library preparation for sequencing.

At some point, they explain their primer and show this:

iTru5_01_A: 5';AATGATACGGCGACCACCGAGATCTACAC tag;ACCGACAA 3';ACACTCTTTCCCTA*C

What is the star for in this sequence:

ACACTCTTTCCCTA*C

This appears in other protocols.

sequencing library dna
• 2,649 views • link
updated by WouterDeCoster WouterDeCoster • written by beausoleilmo beausoleilmo

1 answer

It's some sort of modified nucleotide: phosphorothioate bond

See this page from IDT

• 0 views • link
written by WouterDeCoster WouterDeCoster

Just for the sake of completion, here is the quote from the manuscript:

256 we modified each of the iTru primer sequences by adding a phosphorothioate bond
257 (Eckstein 1985) before the 3’ nucleotide of each sequence to inhibit degradation due to the
258 exonuclease activity of proof-reading polymerases
• 0 views • link
written by Charles Plessy Charles Plessy

Log in to answer this question.

More posts like this