Biostar Beta. Not for public use.
What does 'TLEN' in BAM file mean if mate pairs aligned to different chromosomes?
0
Entering edit mode
15 months ago
verne91 • 10

for example:

E00247:267:HMVT3CCXX:2:1208:32603:44398 161     chr1    29691910        25      23M4I37M87S     chrUn_gl000220  133398  -307    TTCTCTCTCTGTCTGTCTCTTTCTGCTTCTCTCTCTCTCTCTCTCTCTCCCTCTCTCTCTCTCTTTCTGCTCCTCTCTCTTTCTGTTTGTTTCTCTCCCTGTCGTTCTCCCCCCCCTCCTGTCCCTCTTTCTCTCTCTCTCGCTTCCTTGT AAAFFKKKKKKFFKKKKKKKFKKKFFF7FFFKKKKKKKKKKKKKKKKKK7<,F,,,A,,,,,,7,A,,,A,,,,7,,A7,F,,,,,,7,,77,,,F,,,,,,,,,,,,,,,(((((((,,,,,,,,,,,,,,,,,,,,,<A,,,,,,,7,, QT:Z:AAFFFFKK   BC:Z:AAGGGTGA   QX:Z:AAFFFKKKKKKKKKKK   AM:A:0  XM:A:0  RX:Z:CCGTATCTCTGCCAGG   AS:f:-79        RG:Z:NA12878:LibraryNotSpecified:1:HMVT3CCXX:2  XS:f:-80        BX:Z:CCGTATCTCTGCCAGG-1 XT:i:0  OM:i:10

The '@PG' tag:

@PG     PN:longranger.lariat    ID:lariat       CL:lariat -reads=/mnt/10x/analysis/NA12878/PHASER_SVCALLER_CS/PHASER_SVCALLER/_LINKED_READS_ALIGNER/_SORT_FASTQ_BY_BARCODE/SORT_FASTQ_BY_BC/fork0/chnk0/files/reads.fastq.gz -read_groups=NA12878:LibraryNotSpecified:1:HMVT3CCXX:5,NA12878:LibraryNotSpecified:1:HMVT3CCXX:4,NA12878:LibraryNotSpecified:1:HMVT3CCXX:7,NA12878:LibraryNotSpecified:1:HMVT3CCXX:6,NA12878:LibraryNotSpecified:1:HMVT3CCXX:1,NA12878:LibraryNotSpecified:1:HMVT3CCXX:3,NA12878:LibraryNotSpecified:1:HMVT3CCXX:2,NA12878:LibraryNotSpecified:1:HMVT3CCXX:8 -genome=/opt/10x/reference/refdata-hg19-2.1.0/fasta/genome.fa -sample_id=NA12878 -threads=4 -centromeres=/opt/10x/reference/refdata-hg19-2.1.0/regions/centromeres.tsv -trim_length=7 -output=/mnt/10x/analysis/NA12878/PHASER_SVCALLER_CS/PHASER_SVCALLER/_LINKED_READS_ALIGNER/BARCODE_AWARE_ALIGNER/fork0/chnk0/files      VN:0a2f9d6
@PG     PN:longranger.attach_phasing    ID:attach_phasing       VN:2.1.0        PP:lariat
@PG     PN:longranger   ID:longranger   VN:2.1.0        PP:attach_phasing
alignment bam • 579 views
ADD COMMENTlink
0
Entering edit mode

One key important part is missing: how was the alignment generated (e.g. tools, parameters, etc)?

ADD REPLYlink
0
Entering edit mode

I added the '@PG' tag. So the aligner and parameters are there.

ADD REPLYlink
0
Entering edit mode

My guess would be this represent an average of the length for all paired-end reads for this particular fragment, but who knows? This is probably a question best asked of 10x Genomics support, I have found them to be very responsive.

ADD REPLYlink
1
Entering edit mode

10X staff today told me the TLEN is meaningless if the pairs aligned to different chromosomes.

ADD REPLYlink
0
Entering edit mode

...which begs the question on why they report TLEN to begin with in these cases; it seems like that will end up causing someone havoc down the road who doesn't run a sanity check like you have.

ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.3