This is a test version of Biostars. For the public version, visit https://www.biostars.org.
MapSplice Error: could not execute Bowtie

Hi all,

I'm trying to use MapSplice to analysis my RNA-seq data by the following command 

$ python MapSplice_1.15.2/bin/mapsplice_segments.py -Q fq -o outdir -c hg19 -u input.fq -B bowtieIndex
[Tue Jun 27 18:56:19 2017] Checking for chromosomes files or directory
[Tue Jun 27 18:56:19 2017] Checking for chromosomes files or directory passed
[Tue Jun 27 18:56:19 2017] Checking for Bowtie index files
[Tue Jun 27 18:56:19 2017] check reads format
[Tue Jun 27 18:56:20 2017] merge paired end reads remove short
[Tue Jun 27 18:56:28 2017] Mapping reads against hg19 with Bowtie
              [FAILED]
Error: could not execute Bowtie

I indeed have bowtie added in my path. If i type 'bowtie' on terminal, it displaiy the help message. Does anyone meet the same problem?

rna-seq alignment software error
• 1,774 views • link
updated by staypositive • staypositive • written by Nicole • Nicole

3 answers

The tool will try to execute the bowtie program in the bin directory relative to the script and not based on the system path.

Make sure you have bowtie installed there. The default installation should do that.

• 0 views • link
written by Istvan Albert Istvan Albert

Hi, thank you for your answer. I checked the bin dir under MapSplice, bowtie is located in the same path with the script. May there be any other causes of this error?

• 0 views • link
written by Nicole • Nicole

I found the solution. That because the bowtie included in MapSplice didn't support. I download the lastest version of bowtie and copy all the files under bowrie to the bin dir. Then it works. I can't explain why, but it works. I post my solution in case someone might meet the same problem.

• 0 views • link
written by Nicole • Nicole

try use mapsplice 2.0 version

• 0 views • link
written by staypositive • staypositive

Log in to answer this question.

More posts like this
  • Mapsplice2
    written by nkmalini97 • nkmalini97
    No fusions generated. python2 Mapsplice2/mapsplice.py mapsplice_fasta_files/ -x index_files/index -1 read_1_trim.fastq -2 read_2_trim.fastq -o mapsplice_out 2>log.txt The log file is given below: [Mon Jul 19 18:30:27 …
  • Mapsplice Error: convert sam file to junctions failed
    written by praasu • praasu
    Hi, I want to align paired-end RNA-seq using MAPSPLICE on a number of contigs obtained from the De-novo assembly. I am getting error : convert …
  • Error running bowtie
    written by amitunited0532 • amitunited0532
    [2018-03-17 18:25:31] Beginning TopHat run (v2.1.1) ----------------------------------------------- [2018-03-17 18:25:31] Checking for Bowtie Bowtie version: 2.3.2.0 [2018-03-17 18:25:31] Checking for Bowtie index files (genome).. [2018-03-17 18:25:31] …
  • Tophat Reporting output tracks, run out of memory, how to solve?
    written by zoukai3412085 • zoukai3412085
    running log as follow: [2017-11-27 14:14:14] Beginning TopHat run (v2.1.1) ----------------------------------------------- [2017-11-27 14:14:14] Checking for Bowtie Bowtie version: 2.3.3.1 [2017-11-27 14:14:14] Checking for Bowtie index …
  • syntax tophat2 for reference index
    written by marongiu.luigi marongiu.luigi
    Hello, I want to use Tophat to align reading for RNA-seq analysis. I downloaded the sequences SRR390728_1.fastq and SRR390728_2.fastq, quality trimmed with java -jar /usr/bin/trimmomatic …
  • Tophat err =1
    written by Harumi • Harumi
    Hello, I am trying to align my RNAseq data to a reference genome, but it gives me this error message: tophat2 -G Trihar1.gff Trihar1 Cd_C1.trimmomatic_out.fastq …
  • Match read length and quality string length
    written by Jason • Jason
    Hi, I trimmed the first 9 bases of my paired-end RNAseq fastq files and compared the results using FastQC with pre-trimmed *.fastq(s). Now I am …
  • Error When Calling Fusion Junctions With Mapsplice
    written by David Langenberger David Langenberger
    <p>I try to call fusion junctions with MapSplice (1.15.2).</p> <p>My input reads are 100nt in length and in fastq format.</p> <p>Example:</p> <pre><code>@xxxyyyzzz AGATGCACTACCACCCAGCCTATCAGGACAGGCCAAGCCTGAGGACAGTGACTGTCACAGAAAAATAGAAACTTGTGGTTCCAGGAAATCCGAGAGGTCT + IIHIHIHHIHHIHHGHHFGIGHGGGGIIIHHNKIJKIJELHCJFFGLIMLHLGLIAHBIEGFFDJQDAE&gt;HIJHOIMLHAHGGHMPGHIFEJMDVJBEOM …
  • Mapsplice Error
    written by sean760305 • sean760305
    <p>hello, I am running MapSplice and I am able to get the output files, but there is empty in my best_junction.bed file.</p> <p>Furthermore, I got …
  • Mapsplice Reads Format Error
    written by Gabrielw • Gabrielw
    <p>I'm trying to use mapsplice,I used an SRA database file ERR015688.fastq , against hg19 reference genome and bowtie index into the same directory </p> <p>my …