This is a test version of Biostars. For the public version, visit https://www.biostars.org.
miR KEGG enrichment in Arabidopsis

Hello all, I have a list of known miRNA's from an experiment in Arabidopsis (example: ath-MIR166a) and I am looking to find out what biochemical pathways they interact with, with KEGG or reactome.db preferably. I have preformed this analysis in humans several times with no issues. If anybody could push me in the right direction, I would appreciate it, especially if it is a solution in R.

Thank you so much for your time and attention to this matter!

arabidopsis kegg enrichment mir mirna
• 1,839 views • link
written by jnf3769 • jnf3769

Hi JNF3769, I am also working on miRNA's. I have single end fastq files from sequencing centre. I trimmed my fastq files only at the 3'end. The reason for trimming is, generally miRNAs are smaller, so the sequencing machine will sequence the adapter region.

Illumina-SmallRNAAdapter.fa

RNA 3 Adapter TGGAATTCTCGGGTGCCAAGG

Did you trim any other adapters or primers?

I noticed that in miRBase all mature.fasta file has U base instead of T. But my reads have base T in them.

Did you change the base U to T in mature.fa file in order to do alignment?

• 0 views • link
written by bioinforesearchquestions bioinforesearchquestions

I did not need to do alignment or quality control of the sequencing data--it was handed off to me by a legacy researcher and I am more concerned with a qualitative assessment, rather than a quantitative one. I intend to go back and check his work after this to make sure we get the same results, but that is a problem for future me.

• 0 views • link
written by jnf3769 • jnf3769

Thanks, JNF. Currently, I am looking at the preprocessing step. Would you be able to check with that researcher about the above queries?

• 0 views • link
written by bioinforesearchquestions bioinforesearchquestions

0 answers

No answers yet.

Log in to answer this question.

More posts like this