i have a folder with 12 files each file is a txt file with below format: my single file format is as below tab seperated txt file," each id ,count and sequence is newline separated":
ta_iwgsc_2dl_v1_880448_4767 62385 auagcaucauccauccuaccc
ta_iwgsc_5dl_v1_4475147_17525 62385 auagcaucauccauccuaccc
ta_iwgsc_5ds_v1_2769792_21617 51267 ugaagcugccagcaugaucug
ta_iwgsc_2dl_v1_9826058_5702 16290 uuccaaagggaucgcauugau
ta_iwgsc_4dl_v3_14471626_15454 11824 auagcaucauccauccuacca
ta_iwgsc_4dl_v3_14415829_14746 11824 auagcaucauccauccuacca
ta_iwgsc_3ds_v1_2039022_12082 4161 gcucacccucucucugucagc
each file has different ids for same sequences. I need to extract all lines in a new file with a common sequence; for each sequence in each file in that folder. for example :
folder name:common
having 12 txt files with above format.
example file name:CC1 result should be a new file having format:
ta_iwgsc_2dl_v1_880448_4767 62385 auagcaucauccauccuaccc
ta_iwgsc_5dl_v1_4475147_17525 62385 auagcaucauccauccuaccc
file 2:
ta_iwgsc_4dl_v3_14471626_15454 11824 auagcaucauccauccuacca
ta_iwgsc_4dl_v3_14415829_14746 11824 auagcaucauccauccuacca
i am fine with perl ,R, python scripts. tools for extraction is also fyn.
•
written
by
sanjalidhole •
cut -f 3 *.tsv | sort | uniq > uniq_seqs.txt
cat uniq_seqs.txt | while read seq <&0; do
grep -w $seq *.tsv > $seq.txt
done
You can use csvtk uniq (usage)
for f in *.tsv; do
csvtk uniq -H -t -f 3 $f > $f.uniq
done
Damn it, for so many problems there is a neat solution using your tools :-D
Believe me, you'll like it
Let's break this down:
You could use the following code:
cut -f3 yourfile.txt | sort | uniq -d > duplidatesequences.txt
For which you could use the following loop:
for line in $(cat duplicatesequences.txt)
do
grep -w $line yourfile.txt > ${line}.txt
done
thankyou i will try this
will this work on a folder in which we have file1, file2,file3 etc seq1 in file1 is mapped for all seqs in file1; even to all seqs in file2 seqs,file3 seqs......etc and then output a final file of that sequence_name.txt
I don't understand this additional question, please rephrase.
To be honest, I don't get it what you described.
simple u have folder with some files. these files have a same format(mentioned above). take a sequence_1 from file_1 say "ugacugacugac" and find this sequence for all files in that folder. now extract all lines matching to "ugacugacugac" in a new file with file name as "ugacugacugac.txt". do this for all sequences in all files.
see my updated answer
Log in to answer this question.
I modified your post for readability with Markdown code make-up, using the
101010button.