smallRNA - adaptor trimming stringency · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

smallRNA - adaptor trimming stringency

Dear all,

I am trying to analyze my smallRNA seq data and before alignment it is recommended to trim sequenced reads. What stringency for trimming adaptors do you use in your experiments? I have tried with 0.7 and 0.95 adaptor trimming stringency and I got very different results that differ in proportion of mature RNA and iso-miRNA . Any suggestion?

Thank you for your help...

rna-seq adaptors smallrna trimming stringency

• 2,653 views • link

updated 9.3 years ago by Biostar

• written 9.5 years ago by ti&te •

Please show us what commands did you use and adapter sequences used ? How does the length distribution of reads look after trimming adapters.

• 0 views • link

written 9.5 years ago by Chirag Nepal

We use Basespace trimmer app - FASTQ Toolkit. RNA libraries were prepared using NEB smallRNA library preparation kit, where 3' adaptor sequence is AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and 5' adaptor GTTCAGAGTTCTACAGTCCGACGATC.

Pic of trimmed seq distribution: enter image description here

• 0 views • link

written 9.5 years ago by ti&te •

0 answers

No answers yet.

Log in to answer this question.

More posts like this

invalid deflate data (invalid code lengths set)
written 2.6 years ago by leonmcswain •

I am trying to trim paired end reads using Trim-Galore. I have made sure that the files match based on the total reads processed in …
Overrepresented Sequences persistence
written 2.6 years ago by Luna •

Need help addressing overrepresented sequences in my data. I tried trimmomatic at first then trim_galore. Not sure if these overrepresented sequences are due to population …
How to analyze the mirbase mature sequence aligned miRNA output file
written 4.1 years ago by khq5801 •

Hi, I have performed blastn (ncbi-blast+) on my miRNA reads with the miRBase mature miRNA and got the output. I would like to analyze the …
miRNA seq, problems with alignment
written 5.5 years ago by adrian.ramirezdearellano •

Hi everyone. I'm having troubles analyzing some miRNA seq files. First I used cutadapt to trim the universal adaptors. I confirmed that all adaptors and …
AB SOLiD small RNA-seq data handling
written 6.9 years ago by Rodrigo Streit •

Hi everyone, I need to work with SOLiD small RNA-seq libraries from SRA, and I have some questions about quality control and the to-do and …
miRNA/smallRNA adapter triming: Any recommendations for adaptor error rate and sequence Phred?
written 7.8 years ago by ti&te •

I am looking for recommendations on how to trim miRNA/smallRNA sequencing data because the trimming may affect the final results (differences are not enormous, but …
iso-miRNA targeted mRNA
written 9.6 years ago by ti&te •

Dear all, we did small RNA sequencing and now we are analysisng our data. Does anyone know any tool, script or software for iso-miRNA - …
Mirna-Seq Trimming And Mapping?
written 13.1 years ago by daniel.soronellas

<p>Dear community,</p> <p>I have paired-end miRNA datasets which I want to analyze and FASTQC results gave good stats to proceed, but because It's the first …
Problems With Analysis Of Small Rnaseq Data - Adapter Trimming
written 13.3 years ago by Bharat Iyengar

<p>I have always faced a problem while analyzing small RNAseq data, at the step of adapter trimming.</p> <p>I use fastx_clipper to clip adapters. The problem …
Illumina Smallrna-Seq Experiment Using Smrna-Seq V1.5 Library Prep - Strange Results When Aligning …
written 14.5 years ago by Sebastian Kurscheid

<p>Hi,</p> <p>my first question here in BioStar - so hello everyone! :-)</p> <p>We have performed a smRNA-Seq experiment using the Illumina v1.5 smRNA library prep …