smallRNA - adaptor trimming stringency
Dear all,
I am trying to analyze my smallRNA seq data and before alignment it is recommended to trim sequenced reads. What stringency for trimming adaptors do you use in your experiments? I have tried with 0.7 and 0.95 adaptor trimming stringency and I got very different results that differ in proportion of mature RNA and iso-miRNA . Any suggestion?
Thank you for your help...
• 2,653 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Please show us what commands did you use and adapter sequences used ? How does the length distribution of reads look after trimming adapters.
We use Basespace trimmer app - FASTQ Toolkit. RNA libraries were prepared using NEB smallRNA library preparation kit, where 3' adaptor sequence is AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and 5' adaptor GTTCAGAGTTCTACAGTCCGACGATC.
Pic of trimmed seq distribution: