PAML(codeml) reading sequences EOF
Hi all,
I was trying to use PAML (codeml) to calculate dn/ds i converted aligned fasta file to phylip format. but it keeps giving me error. so my output mlc is empty. I pasted the error as below, does anyone know why? thank you!
ns = 7 ls = 22105
Reading sequences, sequential format..
Reading seq # 7: TGCGAGTAAACTCGCCATTCTGCCCCCCATCGACTTGCCACCAATGACCA
EOF at site 21756, seq 7
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Finding genes under positive selection in non-model species - Phylotranscriptomics approach ?
written by sunnykevin97
-
Runmode = -2 in Biopython PAML impossible ?
written by Chvatil
-
Compilation error for PAML
written by elcortegano
-
question about codeml of PAML
written by 21817027 •
-
PAML codeML 4.8 wont give maximum likelihood nor omega estimates
written by mtd66 •
-
PAML needs branch labels in tree
written by dthorbur
-
Problem with script to automate codeml
written by ThulasiS
-
PAML Batch File?
written by zgayk •
-
CodeML Troubleshooting Help
written by p.juttyrajan •
-
Phylogenetic Analysis By Maximum Likelihood (Paml) : Upon Phylip Input Yn00.Clt Program Not Running.
written by Naren
Could it be a windows/unix issue? If you work in linux and edited the file in windows you might try using dos2unix