Hi
I have a DNAStringset containing some sequences of length 25. i want to make an .fq file of it but first i need to add a "specific" header (which stored in a vector) for each read. the data is like this:
A DNAStringSet instance of length 2
width seq names
[1] 25 AGCTTTTCATTCTGACTGCAACGGG coli
[2] 25 ATTTCCTTACTCAACCCCGAAACGC coli
And the result that i want is like:
@coli:1500
AGCTTTTCATTCTGACTGCAACGGG
+
XXXXXXXXXXXXXXXXXXXXXXXX
@coli:1700
ATTTCCTTACTCAACCCCGAAACGC
+
XXXXXXXXXXXXXXXXXXXXXXXX
I can simply make each line and write it to file using cat() function but this is really slow for large datasets. so i found writeXStringSet(data,format=".fq") to use. but i can't find how to prepare my object for using this function.
My question is:
How to prepare my file for this function? or is there any other easy and quick way of doing this?
Thanks all
1 answer
Oh, you'd be best off using BLASTN actually. There is a command line version as well, besides the one hosted on the NCBI website.
Log in to answer this question.
No offense, but can I ask why you want to do this? Because fastq is a specific format for sequencing reads, so for example the rows for each read are important:
If you convert this data the way you've outlined in your post, I'm not entirely clear what your plan is for using it.
yeah of course :) , because i want to use bowtie to find some fragments of a genome in another one, so for sending this fragments to bowtie i need to prepare them as a read