better adding --no-group-separator
I have a long file (fasta) like this:
>Eha-Novel-38_5p
ACCCATTTTCGTCTGAGGATAAT
>Eha-Novel-38_3p*
TTTCCCAGACCCAAATGGGTGC
>Eha-Novel-46_3p
AATGGCGGCCTGATATCCCGGA
>Eha-Novel-46_5p*
TGGGGTATTAAGCCGCGATTGT
>Eha-Novel-44_3p
TATCACAGTCATTTACGGGTAC
>Eha-Novel-44_5p*
TCCCGTATTTGACTGTGACTGAG
I want to print only lines without the "*" and its following line.
Desired output:
>Eha-Novel-38_5p
ACCCATTTTCGTCTGAGGATAAT
>Eha-Novel-46_3p
AATGGCGGCCTGATATCCCGGA
>Eha-Novel-44_3p
TATCACAGTCATTTACGGGTAC
I tried using grep "*" -v -A 1 FILE, but that did not work.
Thanks for your help.
6 answers
I think everyone's overthinking this... to select only the non '*' ending headers (i.e. the lines ending in p) just do:
grep -A 1 ">.*p$" file.fasta >output.fasta
Explanation:
- line starts as a fasta (>)
- has any amount of characters (.*)
- ends with a p (p$)
Then also print the line after it (-A 1).
Edit: To be honest, there's no need for the complicated regex, as we know there's not going to be a 'p' in any sequence lines. So this would work too:
grep -A 1 "p$" file.fasta >output.fasta
I tried to use shell grep, but it's hard to do this.
Try the grep (usage) of SeqKit, just download the executable binary file and run:
./seqkit grep -r -p "\*" -v FILE
>Eha-Novel-38_5p
ACCCATTTTCGTCTGAGGATAAT
>Eha-Novel-46_3p
AATGGCGGCCTGATATCCCGGA
>Eha-Novel-44_3p
TATCACAGTCATTTACGGGTAC
Long-option version:
./seqkit grep --use-regexp --pattern "\*" --invert-match FILE
Hi,
It looks like grep invert search (-v) and context (-A) are not working well together. I found one-liner solutions with sed and awk but here is a less elegant but probably simpler solution using only grep :
grep ">" FILE | grep -v "*" | grep -f - FILE -A 1
This first look for headers in your FILE, then select those without * and use them to search the file again. If speed is not an issue, I guess this is an ok solution.
PS : If you want to remove the "- -" from the output, you can do it with one more grep (or awk, sed or whatever you like).
grep ">" FILE | grep -v "*" | grep -f - FILE -A 1 | grep -v "\-\-"
It works well if the sequences are single-line.
awk '{if(/^>/ && ! /\*$/){getline var; print $0"\n"var}}' FILE
If line starts with ">" and doesn't end in "*", get the next line into var, print the current line, linebreak, and var.
Also, OP please be more meticulous, the title, what you want, and desired output all differ. The above produces desired output (as long as there are no linebreaks in sequences).
This solution is simple, efficient, readable,... Love awk's magic.
I modified it a little bit while you commented. I think it's more clear like this since print $0 doesn't get repeated. If somebody cares, it was like this before:
awk '{if(/^>/ && ! /\*$/){print $0; getline; print $0}}' FILE
If line starts with ">" and doesn't end in "*", print the line, get the next line, print it.
edit. Maybe this is more clear still:
awk '{if(/^>/ && ! /\*$/){print $0; print $(getline)}}' FILE
If line starts with ">" and doesn't end in "*", print the line, print the next line (returned by $(getline)). I don't know if there's any real difference in speed, but I imagine this one is the fastest..
Hi Bastianfromm,
As zjhzwang mentioned, you need to escape the "*", otherwise the standard wild card character greps everything. Afterwards, you need to clean the separators, grep is inserting:
grep -A 1 "\*" in.fa | sed '/--/d' > out.fa
Cheers, Michae
I think you can avoid the separators using the --no-group-separator flag (see man page).
I solved it in two steps
grep --no-group-separator -e ">*\*" -v FILEA|grep ">" > IDS_forgrep.txt
grep --no-group-separator -f IDS_forgrep.txt FILEA -A 1
and in one step
grep --no-group-separator -e "p$" FILEA -A 1
Log in to answer this question.
Maybe you can try:
This way you wouldn't have the sequence, just the identifier.
You are right.Maybe sed works.
sed -n -e "/\p$/ {p;n;p}" FILE >OUTPUTEveryone needs to learn the before and after flags for grep! Just do -A 1 on the grep:
The OP knew about -A, it just doesn't work well with -v.
There's no need to do an inverse search, just search for lines ending 'p'.