This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Edit a single base in SeqRecord object in Biopython?

I just want to edit a single base in one sequence in my single alignment. I read in the alignment file (ie needle-wunsch file) with SeqIO library and I get SeqRecord object. Problem is I know how to edit with .tomutable() for Seq objects but I am not sure how to do that with SeqRecord as it does not have the same function.

Do I have to slice to that position and make a single column SeqRecord object and swap it out at that position with splicing functions?

biopython

1 answer

May be you can try converting the SeqRecord into a Python string:

>>> from Bio.Seq import Seq
>>> sequence=Seq('GCTACGATCGACTAGCTACGATCAGCATCGATC')
>>> type(sequence)
<class 'Bio.Seq.Seq'>
>>> string_sequence=str(sequence)
>>> string_sequence
'GCTACGATCGACTAGCTACGATCAGCATCGATC'
>>> type(string_sequence)
<type 'str'>

And then do whatever you want to do with the string: See this

thanks but I need to keep it in alignment object and I'm not sure you can pull a SeqRecord out and replace it

Log in to answer this question.