I am running a nucleotide BLAST using Python/Biopython. However, I get less (67 hits) results than using the web BLAST (8660 hits) blast.ncbi.nlm.nih.gov/Blast.cgi): https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Get&RID=4EGEHGP901R Biopython states that there are differences but does not point out how to adjust one's parameters to match those on the web interface.
Here is my code: from Bio.Blast import NCBIWWW result_handle = NCBIWWW.qblast("blastn", "nt", "GGCTGTATTCCCCTCCATCG", expect=10, hitlist_size=10000, megablast=False)
hitlist_size=10000 somehow does not return all hits but only hits that have a query cover of 100%. How can I get the other hits that have a query cover of less than 100%?
I experimented with various parameters but they only way to increase the number of hits was via "expect", the expected threshold, which is not exactly what I want.
Thanks for your help!
0 answers
No answers yet.
Log in to answer this question.
i'm upvoting this because your code is the only example of qblast parameters i could find in half a dozen searches - qblast is not well documented :/