This is a test version of Biostars. For the public version, visit https://www.biostars.org.
mirPro error while using RNAfold

Hi!

I am trying to run mirPro on the example data set, however I get following error:

RNAfold < ./run/SRR333598/novel/tmp/precursors.fa --noPS > ./run/SRR333598/novel/tmp/precursors.str

usage:
RNAfold [-p[0|2]] [-C] [-T temp] [-4] [-d[2|3]] [-noGU] [-noCloseGU]
        [-noLP] [-e e_set] [-P paramfile] [-nsp pairs] [-S scale]
        [-noconv] [-noPS] [-circ] [-MEA [gamma]]

can't excute command: RNAfold < ./run/SRR333598/novel/tmp/precursors.fa --noPS > ./run/SRR333598/novel/tmp/precursors.str

RNAfold 2.0 is installed and it functiones with mirDeep2.

Do you have any suggestions how ti fix this issue?

I use following command to run miRpro:

mirpro \
-i SRR333597.fastq \
-i SRR333598.fastq \
-i SRR333599.fastq \
-i SRR333600.fastq \
-d . \
-m mature.fa \
-p hairpin.fa \
-s mmu \
-a ATCTCGTATGCCGTCTTCTGCTTG \
-f miFam.dat \
--novel 1 \
--other rno \
-g Mus_musculus.GRCm38.dna.toplevel.fa \
--index Mus_musculus.GRCm38.dna.toplevel.idx \
-t 4

All the input files are in current directory.

mirpro rnafold mirna prediction

1 answer

So, it looks like I found a problem:

In the command written in the miRPro script RNAfold there is an extra dash before -noPS argument:

RNAfold < ./run/SRR333598/novel/tmp/precursors.fa --noPS > ./run/SRR333598/novel/tmp/precursors.str

while it should be

RNAfold < ./run/SRR333598/novel/tmp/precursors.fa -noPS > ./run/SRR333598/novel/tmp/precursors.str

When extra dash is removed RNAfold runs normally. I guess that now I have to recompile miRPro with a correct command written in mirPRo/V.1.0.1/src/mirpro_novelFinder/src/main.cpp file.

Log in to answer this question.