This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Illumina Miseq fastq file, barcode or no barcode? for Qiime Processing

Hello

The following is the head for one of my paired fastq file:

@HWI-M04771:60:000000000-AURUP:1:1101:15803:1815 1:N:0:TGAGGTTTGATG
TACGGGGGATGCAAGCGTTATCCGGAATCATTGGGCGTAAAGCGCCTGTAGGTTGTTTAGTAAGTCCATTGTTAAAGACCAGGGCTTAACCCTGGGAAAGCAATAGAAACTACTAGACTTGAGTATGGCAGGGGTAGAGGGAATTTCTAGTGTAGCGGTGAAATGCGTAGATATTAGAAAGAACACCGGTGGCGAAAGCGCTCTACTGGACCATTACTGACACTGAGAGGCGAAAGCTAGGGTAGCAAAAGGG
+
BBBBBBFBBBFFEGGCEFGAGAGGGFFF3CAGFGGGHHGGFHFACEEGGGGGEGFEGFHDGHHGHFF<BGHGHHHH>BCCGCCHHFFGGFEEGFC2HGDFEG3FDGG@FGGDGGHFGFGDHHGHFDF?<GHFFHFGFFFDHHGHHHHHGCGHHHGHHHGHHHEGE=DFHHHHHHHHHHHHHEE0EFEAA@DEEHFECEFA?ADBHGGGGGB;BFFHGFEFGFHHGHEEECGGGGGGFFGGGFFFFFFFB>3>>

Since the index sequence is present in the first line, does that imply I need to process it and match it with a separate barcode fastq file using split_libraries_fast.py. I haven't received a barcode file as such from the sequencing lab and want confirm if I need to have that.

Do I have to include it in my mapping file?

Any help is appreciated a lot!

Thanks!

miseq barcode qiime

I'm not familiar with Qiime, but this looks like the run has been demultiplexed (split into barcodes) and the barcodes have been clipped.

These samples are already demultiplexed. See the section on "working with already demultiplexed files" in this QIIME tutorial.

0 answers

No answers yet.

Log in to answer this question.