This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to count tm value by Nearest-neighbor method?

This is a simple formula used to calculate the temperature: Tm = 2(A+T) + 4(G+C) ℃ 

I'm curious about the Nearest-neighbor method.

I get the deltaH and deltaS but when I put this 2 parameter in the formula I got a very small number than the correct answer. Can someone teach me how to count?

wiki: https://en.wikipedia.org/wiki/Nucleic_acid_thermodynamics

This is my primer : GCTAGTTCAACGTCAAGTGTG

Enthalpy : -167 cal/mol

Entropy : -455.9 cal/mol-K

I use this formula

Tm = delta H / (delta S + 1.99 x ( ln(c/4)) - 273.15 = 87.14 C

Tm = (-167 ) / ( -455.9 + 1.99 x ln(c/4)) - 273.15 = -272.8

87.14(correct)

-272.15(my answer)

where c is probe concentration. In this case 0.1

Can someone teach me how to count? Thanks!

pcr tm-value

1 answer

It's because the enthalpy unit is not cal/mol but kcal/mol. So, instead of 167, the value should be 167000.

Log in to answer this question.