Can I compare the e-value results across different Blast program?

Hi everyone,

I'm trying to compare e-values coming from different Blast program exponentially.

I use the same subject database (All-nucl.), only different queries (some are proteins, some are nucl.)

For example, I got e-75 for blastn and e-90 for tblastn for the same subject sequence, then can I say that this subject sequence is more related to e-90?

Because the equation of blastn and tblastn are different in K. ( enter image description here )

Can anyone help me with this?

Thanks a lot

blast

• 2,473 views • link

written 9.7 years ago by qingxiangg •

This thread discusses BLAST evalue comparison.

• 0 views • link

written 9.7 years ago by Sej Modha

Thanks Modha! I've seen that post before and in fact the problem haven't been solved. Thanks anyway!

• 0 views • link

written 9.7 years ago by qingxiangg •

0 answers

No answers yet.

More posts like this

tblastn BLAST+ segmentation fault
written 4.4 years ago by bl02015 •

Dear colleagues, I keep getting a segmentation fault message whenever trying to run a tblastn command: tblastn -db genome.fna -query protein.fas -out protein.out -num_threads 14 …
Matching Query ID and Subject ID in a new file
written 6.3 years ago by jamie.pike

Hi, I am trying to write a script that takes a list of genomes, performs BLASTN, creates a file containing the sequence of the BLASTN …
Find overlapping blast hits and keep the highest evalue
written 6.4 years ago by maxime.policarpo

Hi everyone, I am performing tblastn with a set of >1000 proteins as queries against a genome. I am trying to keep every regions of …
BLAST using Biopython
written 7.2 years ago by a.lathifbt •

Hello.I am new to biopython and I am trying to do BLAST search for a single query sequence. This is the script I wrote: """ …
BioPython BLAST Records HSP Sequences
written 8.1 years ago by samvanstroud •

When using BioPython to BLAST sequences online through the NCBI (https://www.ncbi.nlm.nih.gov/BLAST), we recieve back BLAST record objects. blast_record = NCBIXML.read(result_handle) We can access HSPs using …
E value cut-off for multiple sources of multiple sequences alignments
written 8.5 years ago by litianliang12 •

Dear All, As we know, when we generate multiple sequence alignments, we usually set a E value cutoff as a threshold. Here is the E …
It should be easy, but...How to keep best hits in blast result when encountering frame shift?
written 10.0 years ago by qingxiangg •

Hello everyone, I'm using Blast+ 2.4.0 This is my question and it bothered me for a while. And this is not duplicate of previous questions …
blastn query coverage filter
written 10.0 years ago by fortwatts •

I have test.fasta consisting of a single header and read: \>why_no_blast_hit CTGATATCTACATACGTACTCGAGCATCGATCGATGACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCGAGCATCGATCGATGTACAGCTACGTACGTCTTGAGCATCGATCGATGTACAGCTACG TACGTCGAGATCAGAGTGA Using this as the query in the latest version of blast+ and …
tBLASTn can`t find proteins annotated in same genome. Is that possible?
written 11.7 years ago by biotech

Seems, tBLASTn can't find some of the proteins that were annotated using PGAAP pipeline. Here is the code and the results: ``` # download Nagasaki …
Blast K and Lambda
written 11.8 years ago by Haifeng •

Hello, I have a question about Blast parameter. In Blast search results, for different queries the K and Lambda value is different for Ungapped search. …