This is a test version of Biostars. For the public version, visit https://www.biostars.org.
FastQC contaminant line error

I'm running FastQC on a set of raw fq reads that were generated by NextSeq. On some files, but not all, I get the error "Expected 2 sections for contaminant line but got 1 from Illumina Paired End”. It looks like it originates from the contaminant finder module (see here: https://github.com/csf-ngs/fastqc/blob/master/uk/ac/bbsrc/babraham/FastQC/Sequence/Contaminant/ContaminentFinder.java). However, I've never specified the contaminants option and this error does not come up for other files, despite being run in exactly the same way. Any ideas?

Thanks for your help!

fastqc contaminant error

Following is only a vague suggestion but something to look at while you wait for a more informed response.

Sounds like your data may have been trimmed on the instrument (or in BaseSpace) and I wonder if the reads may now be out of order, if one of the reads from a pair was discarded during trimming.

Can you do a quick check on the file pairs to see if you have the same number of reads in both R1/R2. If not, you would need to fix that by using repair.sh from BBMap suite.

Huh! I didn't know the instrument or BaseSpace could trim reads. However, it looks like there are the same number of reads in R1/R2. Thanks for the suggestion. I'll check that now each time I get reads back from an instrument.

1 answer

OK, slightly late, but this is very likely caused by using spaces rather than tab stops to separate your identifiers from the actual sequence, in contaminant_list.txt.

OK, slightly late, but this is very likely caused ...

If 9 years later is slightly late, then I have never been late :-)

Confirmed:

The error arises from FastQC parsing a contaminant_list.txt file where lines use spaces instead of tabs between contaminant names and sequences, causing it to detect only one section instead of two.

FastQC loads this file from local directories even without the --contaminants option, which may differ across runs.

Locate the file with:

find ~ -name contaminant_list.txt 2>/dev/null

Edit to ensure each non-comment line has a single tab, e.g.:

Illumina Paired End PCR Primer 1    GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG

Or delete it to use the default.

Mismatched read counts are not the issue, as you confirmed they match.

Log in to answer this question.