This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Length of BLAST align sequence as in FASTA format?

I am trying to understand how the BLAST align sequence searches for the sequences?. I understand that, sequences aligned to 60 letters and in multiple lines, in FASTA format.

Does BLAST aligns only 60 --> 60 sequences or does it combines all the sequences (2000 or 3000 ) and aligns it?

Thanks

sequencing alignment blast
• 2,311 views • link
updated by Biostar Biostar • written by errajasankarchem • errajasankarchem

2 answers

It doesn't change anything whether your sequence looks like this :

>my_seq.fasta_3x20
AGCGGCGCGAAGTTGGTGTC
AGTTGGTGTCGTGGTCAAAA
GTGGTCAAAAAGCGGCGCGA

or like this :

 >my_seq.fasta_1x60
 AGCGGCGCGAAGTTGGTGTCAGTTGGTGTCGTGGTCAAAAGTGGTCAAAAAGCGGCGCGA

Does it answer your question ?

• 0 views • link
written by Carlo Yague Carlo Yague

It is just a format like 3x20 or 1x60 is same. Aptly put. Appreciated.

• 0 views • link
written by errajasankarchem • errajasankarchem

If you are referring to 60 characters per line (in some fasta files) then that is just a visual aid to make the files look readable/fit on a screen page. In reality the fasta DNA sequence is a single long string which blast chops into "words" (7-11 bp for nucleotides) which are then used for initiating the search.

• 0 views • link
written by GenoMax GenoMax

Thanks for the answer. I just thought it would search only that 60 string chars.

• 0 views • link
written by errajasankarchem • errajasankarchem

Log in to answer this question.

More posts like this