Basically, an original paper looked at a C>G mutation on the forward strand, our Taqman is designed on the reverse strand for a G>C mutation. Does this mean that we have to invert our results to compare them to the original paper? i.e. We can't directly compare our GG results to their GG results?
I came across this answer (https://abcommunity.thermofisher.com/community/real-time_pcr/blog/2014/07/24/which-allele-is-detected-by-my-snp-assay-probes), which has only served to confuse me further... They're using rs3892097 (G>A) as an example. It's oriented on the reverse strand.
"For example, the C__27102431_D0 assay, which targets the CYP2D6*4 g.1846G>A SNP, rs3892097, has the following context sequence: AGACCGTTGGGGCGAAAGGGGCGTC[C/T]TGGGGGTGGGAGATGCGGGTAAGGG" So from this, I gather that they're saying as it's on the reverse strand - C is being read for G, and T for A? Which confuses me over my own question as to whether or not I need to reverse my results to compare like with like.
Any help clarifying this would be greatly appreciated!!
0 answers
No answers yet.
Log in to answer this question.