Hi all
How I parse FASTA file to get information about gene location ( i.e. get numbers start of gene and the end)?
>lcl|NC_000913.3_cds_NP_414542.1_1 [gene=thrL] [protein=thr operon leader peptide] [protein_id=NP_414542.1] [location=190..255]
ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGA
>lcl|NC_000913.3_cds_NP_414547.1_6 [gene=yaaA] [protein=peroxide resistance protein, lowers intracellular iron] [protein_id=NP_414547.1] [location=complement(5683..6459)]
ATGCTGATTCTTATTTCACCTGCGAAAACGCTTGATTACCAAAGCCCGTTGACCACCACGCGCTATACGC
TGCCGGAGCTGTTAGACAATTCCCAGCAGTTGATCCATGAGGCGCGGAAACTGACGCCTCCGCAGATTAG
•
written
by
Am.A •
If I understood your question correctly, this solution with Python 3.x might help you,
with open("seq.fa") as f:
for line in f:
line = line.rstrip()
if line.startswith('>'):
line1 = line.split()
print(": ".join([line1[0], line1[-1].strip('[location=complement()]')])) #add characters you want to strip
Output:
>lcl|NC_000913.3_cds_NP_414542.1_1: 190..255
>lcl|NC_000913.3_cds_NP_414547.1_6: 5683..6459
Don't write a parser if it already exists... in this case the answer is SeqIO from Biopython
Log in to answer this question.
Okay, you have my permission to do so.
But what is the question? Have you tried googling?
But you don't have my permission to give OP permission :-)
Unless OP edited the question after you wrote your comment it does appear to have a reasonably clear description. On a serious note, can we have more of what @Medhat did and less of these comments?
Indeed, the post was edited and didn't contain a question at all when I placed my comment asking about what the question would be. I realize that my answer (with the edited original post) makes me look like a douche.
you can find exactly what you need in previous question
Correct Way To Parse A Fasta File In Python
bonus
read this
https://github.com/mdshw5/pyfaidx
@Am.a: It generally helps to be explicit about the output you want when you write the original post. For example in this case do you only need