This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Use BLAST algorithms to discover function of a gene

I have a sequence, for example this one :

> seq1
ATGAGCAGGAACAGGCTGTTCCTGGTGGCCGGCAGCCTGGCCGTGGCCGCCGCCGTGAGC
CTGATCAGCGGCATCACCCTGCTGAACAGGGACGTGGGCAGCTACATCGCCAGCCACTAC
AGGCAGGAGAGCAGGGACGTGAACGGCACCAGGTACCTGTGCACCGGCAGCCCCAAGCAG
GTGGCCACCACCCTGGTGAAGTACCAGACCCCCGCCGCCAGGGCCAGCCACACCGACACC
GAGTACCTGAGGTACAGGAACAACATCGTGACCGTGGGCCCCGACGGCACCTACCCCTGC

I'm supposed to use a selection of BLAST algorithms to accomplish a task of discovery functions of these gene.

(Search sequence databases for similar genes or proteins in order to assign a function to a newly sequenced piece of DNA)

I used to have extra information about the sequence, but not this time, I don't know from where should I start, can anyone guide me ?

blast
• 2,498 views • link
updated by natasha.sernova natasha.sernova • written by Bilal • Bilal

I've got this for your sequence:

This is probably a bacterial protein, similar to some TB-protein, tubercilesis-protein.

79% of identity.

• 1 views • link
written by natasha.sernova natasha.sernova

1 answer

See these links. I think you have started going in the right direction.

http://www.ncbi.nlm.nih.gov/guide/howto/find-func-gene/

• 1 views • link
written by natasha.sernova natasha.sernova

In the Step 2 : "Paste the sequence in the query box, choose a database, and click the BLAST button", how can I know which DB should I choose, or I'll just try all of them until I get the desired results ?

• 1 views • link
written by Bilal • Bilal

Blastn should give you some information for any protein.

What DB to use - nr, non-redundant sequences.

NCBI-home page address:

www.ncbi.nlm.nih.gov

Then press "nucleotide" on the left side, then copy-paste your sequence

and wait a little bit. If you have many of them, use batch-mode.

• 1 views • link
written by natasha.sernova natasha.sernova

Log in to answer this question.

More posts like this