This is a test version of Biostars. For the public version, visit https://www.biostars.org.
convert text file to fasta file

Hi

It might be very simple question, but i could not convert the text file which has sequences in below format.. to .fasta file??

>gi|4|emb|X17276.1| Giant Panda satellite 1 DNA
GATCCTCCCCAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGAGGTGTTTTCCT
GGACGCTCTGCTTTGTTACCAATGAGAAGGGCGCTGAATCCTCGAAAATCCTGACCCTTTTAATTCATGCTCCCTTACTC
ACGAGAGATGATGATCGTTGATATTTCCCTGGACTGTGTGGGGTCTCAGAGACCACTATGGGGCACTCTCGTCAGGCTTC
CGCGACCACGTTCCCTCATGTTTCCCTATTAACGAAGGGTGATGATAGTGCTAAGACGGTCCCTGTACGGTGTTGTTTCT
GACAGACGTGTTTTGGGCCTTTTCGTTCCATTGCCGCCAGCAGTTTTGACAGGATTTCCCCAGGGAGCAAACTTTTCGAT
GGAAACGGGTTTTGGCCGAATTGTCTTTCTCAGTGCTGTGTTCGTCGTGTTTCACTCACGGTACCAAAACACCTTGATTA
TTGTTCCACCCTCCATAAGGCCGTCGTGACTTCAAGGGCTTTCCCCTCAAACTTTGTTTCTTGGTTCTACGGGCTG
>gi|7|emb|X51700.1| Bos taurus mRNA for bone Gla protein
GTCCACGCAGCCGCTGACAGACACACCATGAGAACCCCCATGCTGCTCGCCCTGCTGGCCCTGGCCACACTCTGCCTCGC
TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG
TGGTGAAGAGACTCAGGCGCTACCTGGACCACTGGCTGGGAGCCCCAGCCCCCTACCCAGATCCGCTGGAGCCCAAGAGG
GAGGTGTGTGAGCTCAACCCTGACTGTGACGAGCTAGCTGACCACATCGGCTTCCAGGAAGCCTATCGGCGCTTCTACGG
CCCAGTCTAGAGCTTGCAGCCCTGCCCACCTGGCTGGCAGCCCCCAGCTCTGGCTTCTCTCCAGGACCCCTCCCCTCCCC
GTCATCCCCGCTGCTCTAGAATAAACTCCAGAAGAGG
blast

Need to add > before identifier, in this case "gi|4|emb|X17276.1| Giant Panda satellite 1 DNA" and "gi|7|emb|X51700.1| Bos taurus mRNA for bone Gla protein". Header and sequence should be on separate lines.

>gi|4|emb|X17276.1| Giant Panda satellite 1 DNA
GATCCTCCCCAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGAGGTGTTTTCCTGGACGCTCTGCTTTGTTACCAATGAGAAGGGCGCTGAATCCTCGAAAATCCTGACCCTTTTAATTCATGCTCCCTTACTCACGAGAGATGATGATCGTTGATATTTCCCTGGACTGTGTGGGGTCTCAGAGACCACTATGGGGCACTCTCGTCAGGCTTCCGCGACCACGTTCCCTCATGTTTCCCTATTAACGAAGGGTGATGATAGTGCTAAGACGGTCCCTGTACGGTGTTGTTTCTGACAGACGTGTTTTGGGCCTTTTCGTTCCATTGCCGCCAGCAGTTTTGACAGGATTTCCCCAGGGAGCAAACTTTTCGATGGAAACGGGTTTTGGCCGAATTGTCTTTCTCAGTGCTGTGTTCGTCGTGTTTCACTCACGGTACCAAAACACCTTGATTATTGTTCCACCCTCCATAAGGCCGTCGTGACTTCAAGGGCTTTCCCCTCAAACTTTGTTTCTTGGTTCTACGGGCTG
>gi|7|emb|X51700.1| Bos taurus mRNA for bone Gla protein
GTCCACGCAGCCGCTGACAGACACACCATGAGAACCCCCATGCTGCTCGCCCTGCTGGCCCTGGCCACACTCTGCCTCGCTGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGGTGGTGAAGAGACTCAGGCGCTACCTGGACCACTGGCTGGGAGCCCCAGCCCCCTACCCAGATCCGCTGGAGCCCAAGAGGGAGGTGTGTGAGCTCAACCCTGACTGTGACGAGCTAGCTGACCACATCGGCTTCCAGGAAGCCTATCGGCGCTTCTACGGCCCAGTCTAGAGCTTGCAGCCCTGCCCACCTGGCTGGCAGCCCCCAGCTCTGGCTTCTCTCCAGGACCCCTCCCCTCCCCGTCATCCCCGCTGCTCTAGAATAAACTCCAGAAGAGG
awk '{ if ( $0 ~ /^gi/ ) {gsub(" ","_",$0); print ">"$0 } else { print } }' in.txt > out.fasta

Hi

Thank you ... The ">" is already there in the file. Can i use the above command to execute it. Will it just replace the symbol ">" or it adds to the existing file?

If its already there, then its already a fasta file. Whats the problem then ? You just rename your file from text to .fasta

The above command does not work. If you want to replace space with "_",

awk '{ if ( $0 ~ /^>gi/ ) {gsub(" ","_",$0); print $0 } else { print } }' in.txt > out.fasta

Thank you. I used the above command for the complete nucleotide database it suddenly stops saying segmentation error core dumped. Is there any any other way i can do it??

The '>' gets auto-formatted on Biostars. So OP probably posted it.

The file you posted looks like a fasta already. How did you try to convert and what makes you think it didn't work?

Hi sir

I need to generate index file for the blast nt file to do blast search. I used the makeblastdb command to generate index file. I got an error during this process saying duplicate seqIds. To remove duplicate sequences in the nt file i tried with uclust. I could not do uclust since the nt file is in text but not in fasta format..

Is nt = nucleotide file or nt as in NCBI NT file?

If it is the first then do this

grep "^>" your_file.fa | sort | uniq -c

That should show you what ID's are duplicated. Edit the file to remove those duplicates.

It is NCBI NT file. Its a big file. If i can split this file into atleast two files i think i can remove the duplicates

Why are you creating your own indexes when you can download the pre-formatted from NCBI directly?

I downloaded all 39 NT files and extracted. When i run blast below command

blastn -query contigs.fa -db ntdb -outfmt 6 > known_sequences.blastx.nt.hits.txt

I got the below error.

BLAST Database error: No alias or index file found for nucleotide database [ntdb/] in search path

How can i solve this

You can't makeup your own blast db name. use -db nt (with full path if needed).

thank you :) it worked

0 answers

No answers yet.

Log in to answer this question.