This is a test version of Biostars. For the public version, visit https://www.biostars.org.
bwa sampe: paired ends with different names

I'm trying to align sequences I downloaded from the SRA with the dmel reference genome. After I align each paired ended fastq with the reference (with bwa aln), I try to run bwa sampe to get the .SAM.

This part of my shell script follows:

bwa aln -n 0.1 -t 8 dmel_ref.fasta "$i"\_"1.fastq" > "$i"\_"1.sai" 2>log/"$i"\_"1.sai.log"
bwa aln -n 0.1 -t 8 dmel_ref.fasta "$i"\_"2.fastq" > "$i"\_"2.sai" 2>log/"$i"\_"2.sai.log"
bwa sampe -a 800 -r '@RG\tID:foo\tSM:bar' dmel_ref.fasta "$i"\_"1.sai" "$i"\_"2.sai" "$i"\_"1.fastq" "$i"\_"2.fastq" > "$i.sam" 2>log/"$i.sam.log"

The tail of the .sam.log (STDERR from bwa sampe) is:

[infer_isize] inferred maximum insert size: 600 (6.52 sigma)
[bwa_sai2sam_pe_core] time elapses: 4.27 sec
[bwa_sai2sam_pe_core] changing coordinates of 818 alignments.
[bwa_sai2sam_pe_core] align unmapped mate...
[bwa_paired_sw] 832 out of 2416 Q17 singletons are mated.
[bwa_paired_sw] 114 out of 4353 Q17 discordant pairs are fixed.
[bwa_sai2sam_pe_core] time elapses: 0.55 sec
[bwa_sai2sam_pe_core] refine gapped alignments... 0.16 sec
[bwa_sai2sam_pe_core] print alignments...
[bwa_sai2sam_pe_core] paired reads have different names: "SRR1525696.81815875", "SRR1525696.81815878"

How can I fix this? I didn't do any previous trimming, I just used the downloaded .fastq from SRA.

Thank you!

alignment next-gen bwa software error
• 4,318 views • link
written by mufernando • mufernando

1 answer

Perhaps out of sync files were uploaded to SRA by error.

Run repair.sh from BBMap (find the syntax on the linked page) to see if you can fix the issue.

• 1 views • link
written by GenoMax GenoMax

I've tried that already, but I get the following error:

/usr/local/bin/repair.sh: line 71: /usr/local/bin//calcmem.sh: No such file or directory
/usr/local/bin/repair.sh: line 72: parseXmx: command not found
/usr/local/bin/repair.sh: line 76: freeRam: command not found
java -ea -Xmxm -cp /usr/local/bin/current/ jgi.SplitPairsAndSingles rp in=SRR1525696_1.fastq in2=SRR1525696_2.fastq out=SRR1525696_1_fixed.fastq out2=SRR1525696_2_fixed.fastq outs=singleton.fastq
Invalid maximum heap size: -Xmxm
Error: Could not create the Java Virtual Machine.
Error: A fatal exception has occurred. Program will exit.
Error: A fatal exception has occurred. Program will exit.
• 1 views • link
updated by GenoMax GenoMax • written by mufernando • mufernando

Are all BBmap suite scripts in one folder? It appears that you may have moved repair.sh out of the BBMap folder into /usr/local/bin.

You could manually run this command in the directory where the fastq files are present.

java -ea -Xmx2g -cp /usr/local/bin/current/ jgi.SplitPairsAndSingles rp in=SRR1525696_1.fastq in2=SRR1525696_2.fastq out=SRR1525696_1_fixed.fastq out2=SRR1525696_2_fixed.fastq outs=singleton.fastq
• 1 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this
  • Error with samtools index command
    written by owenz • owenz
    Hello everyone, I am fairly new to bioinformatics. I am currently learning the command line and was writing a very simple script to align multiple …
  • Bwa producing no alignment
    written by ThePresident ThePresident
    I am dealing with Illumina paired-end, 150 bp read-length datasets. Here's what my fastq files looklike: @SRR3405394.1 1 length=151 NCGACTGAGGTAATTACAGTTCTTCGGTTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAACGTGCAGGGTACAGATCGGAA +SRR3405394.1 1 length=151 #<GGGGAGGIGGGIGGIIIIIGIIIIIIIIIIGIIIIIIIGGIIGIGGIIIIIGIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIGIGGIGGIIGGIIIIIGGGIIIIIGGIIIIGIIIGIGII<GGGGAGIGGAGG I …
  • insert size discrepencies using bwa backtrack and bwa mem
    written by urmi208 • urmi208
    Hi all, I have a question regarding bwa-mem and bwa aln. I am trying to align 150 bp paired end data against a genome assembly …
  • bwa sampe error [fread] Unexpected end of file
    written by gsuryawanshi • gsuryawanshi
    I am running following command to convert paired end .sai output of bwa aln to one sam file: bwa sampe ref.fa read1.sai read2.sai read1.fastq read2.fastq …
  • bwa error: paired reads have different names
    written by vjmorley • vjmorley
    I'm getting an error when I try to pair my reads using bwa (version 0.7.10-r789). Here's my pipeline: Trim for quality using fastx `fastq_quality_trimmer` ``` …
  • Very large inferred maximum insert size!
    written by Nikleotide Nikleotide
    I'm trying to align some MiSeq reads (paired end) with bwa aln. The size of the data is relatively small but when I get to …
  • bwa mem vs bwa aln
    written by Adrian Pelin Adrian Pelin
    <p>Hello,</p> <pre> My data is 100bpx2 HiSeq PE reads, some PE overlap so I merged them into SE. For my analysis I used the aln …
  • BWA paired reads have different names error
    written by crysis405 • crysis405
    ``` [bwa_sai2sam_pe_core] convert to sequence coordinate... [infer_isize] (25, 50, 75) percentile: (144, 213, 328) [infer_isize] low and high boundaries: 100 and 696 for estimating avg …
  • Bwa Sampe Segmentation Fault
    written by a11msp a11msp
    <p>Hi everyone,</p> <p>I'm running <a href='http://bio-bwa.sourceforge.net/'>bwa</a> in the sampe mode and, after successfully processing &gt;10M reads it fails with a segmentation fault (as follows) on …
  • Bwa Error While Trimming Color Space Data
    written by Farhat Farhat
    <p>I am using the following pipeline for aligning some paired end SOLiD data. </p> <pre><code>bwa aln -c -n 0.06 -o 2 -t 8 -q 10 …