This is a test version of Biostars. For the public version, visit https://www.biostars.org.
I want to Parse Blastn output file which is in Pairwise alignment format and get coordinates of best hits of target genome excluding gaps??

Hi, i am working with blastn stand alone version which performs local alignment between query and target. The output was obtained in pairwise alignment format. here is Blastn output sample.

BLASTN 2.2.26 [Sep-21-2011]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.

Query= chr1:27646199-27646677 (478 letters)

Database: HomoSapeinsHg19_WholeGenomeSequence.fa

       93 sequences; 3,137,161,264 total letters

Searching..................................................done

Sequences producing significant alignments:

chromosome Score(bits) E_Value

chr1 46 0.019

target= >chr1

      Length = 249250621

Score = 46.1 bits (23), Expect = 0.019

Identities = 20/23 (86.95%) Strand = Plus / Minus

Query: 352 ggctccctcctcccgcggcccgg 374

        |||||||||||   |||||||||

Sbjct: 100 ggctccct---cccgcggcccgg 123

Expected Output:

i want to parse the pairwise alignment files and get coordinates of target hits without gaps. like

chr1 100 108

chr1 111 123

Any suggestion will be appreciated...thanks in advance

alignment blast

You want to:

get coordinates of target hits without gaps

Isn't there a gap right there:

Sbjct: 100 ggctccct---cccgcggcccgg 123

?

In case the blast did not run too long, you should really just do it again and use -outfmt 6 for tab separated values that are so much easier to play with.

0 answers

No answers yet.

Log in to answer this question.