Kover is an out-of-core implementation of the Set Covering Machine algorithm that has been tailored for genomic biomarker discovery. Given two groups of phenotipically distinct individuals represented by their genomes, Kover seeks an intelligible model that accurately discriminates them. The obtained models are conjunctions (logical-AND) or disjunctions (logical-OR) of rules that capture the presence or absence of k-mers.
For example, when applied to 462 C. difficile isolates divided into two groups: resistant or sensitive to the antibiotic Azithromycin, Kover found that the following model is a good predictor of resistance to this drug:
Presence(AGCCAGGTTCTTCATTTAAGATGCTAACTTC)
OR
Presence(CTTAAGCTGCCAGCGGAATGCTTTCATCCTA)
OR
Presence(AAGTCGCCCTTTTTTAAGGATACGGCGGTAT)
Kover has been found to outperform the widely used pipeline consisting of using univariate feature selection (e.g. chi2 test) coupled with a learning algorithm (e.g.: SVM, CART). These results are described in:
Drouin, A., Giguère, S., Déraspe, M., Marchand, M., Tyers, M., Loo, V. G., ... & Corbeil, J. (2016). Predictive computational phenotyping and biomarker discovery using reference-free genome comparisons. bioRxiv, 045153.
Need help?
We will answer Biostar questions regarding:
Post a question: link
See all posts: https://www.biostars.org/t/kover/
Tool availability
Implementation: https://github.com/aldro61/kover/
Documentation: http://aldro61.github.io/kover/
Tutorial: http://aldro61.github.io/kover/doc_example.html
-- Kover authors
•
written
by
Alexandre Drouin
Hi, I'm having problem installing Kover. Usually I use a cluster from my university and the support staff failed to install Kover as a user. Do I need root privilege in order to use Kover? Suspecting this being true, I tried to install Kover on my desktop (an iMac) and still got a variety of errors. Should I post those errors here?
Thanks!
It would be most appropriate to create a new post with kover as tag: https://www.biostars.org/p/new/post/?tag_val=kover. And posting the errors will probably be most informative for those trying to help you.
Hi, like WouterDeCoster suggested, please create a new post with "kover" as a tag and post the full error messages. Also, please ensure that you have installed all the software dependencies: https://aldro61.github.io/kover/doc_installation.html#prerequisites. You do not need root privilege to run Kover. --Alex
Log in to answer this question.
Could you post some examples on why we would want to use Kover also here?
Thanks for the suggestion! I added an example in the description and a link to a hands-on tutorial.