This is a test version of Biostars. For the public version, visit https://www.biostars.org.
perl programming for retriving sequences sequenc

i have a text file with gene id (gene_id.txt eg. n0_g1_i1; n0_g1_i11; n0_g1_i17 and other lakhs of gene id are there in the gene_id file ) and a denovo assmebly file (Triniry.fasta)

>n0_g1_i1 len=86
TTATGAACATGCATTTTCCTGCTCCTGCTTTTTCTACTTAATACGTGAGTAGATAATAAATATCGGAAAAATATTTAAATAATAAT
>n1_g1_i1 len=85
GAGGGGGTTCCTTTACTTAAAACTACACTTGAAAATAATGATTATAACATACCGTCATTATTAAATATTAGCAAAAACCGTGAT

(it ih a header of the assmbled file). i need to extract all the sequencces from the assmbly file which are present in the gne_id.txt. how should i retrive the sequences from the assembly file using perl script???

rna-seq gene sequence assembly

What do you mean by "extract" sequences? Are you looking to map these sequences to the trinity assembly?

yes.. i want to map it and extract the sequences

You just want to pull out the sequences from multi fasta using the gene_id.txt file right ?

yes sir... i want to pull out the sequences from multi fasta using the gene_id.txt file right

That is an odd request.
So you just want to see which larger sequence these original sequences became part of? You could use blat/blast with some post-alignment filtering to achieve that.

No. He wants to retrieve the sequences from large multi fasta file based on matching IDs present in another text file.

yes sir, you are right... how should i do it??? @ goutham sir

That information was in the link @Goutham put below in the post that closed this thread.

i can extract the gene id and their description.. but i am unable to pull out the sequences...

Please spend time in reading and understanding the posts mentioned in the below link ?

sir, i want a perl script not bio.perl or any other script. i got other script but not perl script..

Why does it need to be a perl script (short of requirement for a homework which needs the program to be in perl).
There are many possible options in the search below. If you need a perl solution search biostars using google and you will find the right threads.

Hello Bulbul Ahmed!

We believe that this post does not fit the main topic of this site.

This question has been asked several times and you could find multiple ways to do this.

https://www.biostars.org/local/search/page/?q=extract+fasta+ids

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

0 answers

No answers yet.

Log in to answer this question.