This is a test version of Biostars. For the public version, visit https://www.biostars.org.
base space upload

I am trying to upload a FASTq file from GAII to basespace but it always give error that reads dont pass filter and uplaod failed

This file contains reads that did not pass filter, according to the first cluster header: @HWUSI-EAS1764:39:64WJWAAXX:4:1:6774:1164 1:Y:0:GCCAAT

I have carefully named the file This is happening with most of files generated with HI-seq2000 also. Illumina support says it is not in acceptable format but has no solution. Any insight or experience on this please

fastq basespace

What is not in an acceptable format? The file name? Edit your question to include the file name you are trying to upload.

Illumina say there typical Fastq (bcl2fastq) is

    @SN123:449:HHGC5BCXX:1:1101:1707:2167 1:N:0:TACGTG 
    AGATGCAACAGAAGGAGGTACGGTG
    +
    @DBD@HICHH?1G@11DCHH@H/<1
    @SN123:449:HHGC5BCXX:1:1101:1637:2213 1:N:0:TACGTG 
    CGGATCGCCTCGATCCTCTTCGGTG
    +
    DDDDDIIIIIIIIIIIIIIIIHIII
    @SN930:449:HHGC5BCXX:1:1101:1969:2183 1:N:0:TACGTG 
    GCACCTGCTGCCTCAGGACTCGGTG
    +

However i receive from Seq core something like this-

@HWI-ST550_0117:8:1101:1433:2103#GCCAAT/1
NGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTG
+HWI-ST550_0117:8:1101:1433:2103#GCCAAT/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWI-ST550_0117:8:1101:1459:2118#GCCAAT/1
NTTGGAGCAGGTGCTTTCTGGGCTGGGGTCTTCTGACCCTTCTGACCTTTAG
+HWI-ST550_0117:8:1101:1459:2118#GCCAAT/1

File you received is in the older Illumina 1.4+ sequence identifiers format. See the format here.
Current headers are in first example.

Should i use Fastq groomer to convert this into sanger and Iluimna 1.8 ? The core may not do anything

If the Q-scores in the file are in phred+64 format then fastq groomer would help but I don't think it will change the fastq header format (Must admit I have not looked at this before).
This format has not been in use for a long while. Is this old data that you have retrieved from the lab?

Yes several years old and is from GA-II

reformat.sh from BBMap (or fastq_groomer) can take care of the Q-scores (which you will need to convert) but you will need to deal with the headers programatically. Otherwise analyze data outside basespace.

0 answers

No answers yet.

Log in to answer this question.