This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Modifying barcode sequence in fq files

Hello,

I have several .fq files containing 5bp inline barcodes at the beginning of each read such as (barcodes are between *) :

@gi|110640213|ref|NC_008253.1|_418_952_1:0:0_1:0:0_0/1
*CCAGG*CAGTGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCATCTGGTAGCGATGAT
+
2222222222222222222222222222222222222222222222222222222222222222222222
@gi|110640213|ref|NC_008253.1|_31_476_0:0:0_0:0:0_1/1
*CAGAT*GGTTGGTGATTTTGGCGGGGGCAGAGAGGACGGTGGCCACCTGCCCCTGCCTGGCATTGCTTTCC
+
2222222222222222222222222222222222222222222222222222222222222222222222
@gi|110640213|ref|NC_008253.1|_210_743_2:0:0_1:1:0_2/1
*CATTA*CCACCACCATCACCATTACCACAGGAAACGGTGCGGGCTGACGCGTACAGGAAACACCGAAAAAA
+
2222222222222222222222222222222222222222222222222222222222222222222222

I would like to modify these sequences in order to have the same for each read (here it would start by AAAAA):

@gi|110640213|ref|NC_008253.1|_418_952_1:0:0_1:0:0_0/1
*AAAAA*CAGTGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCATCTGGTAGCGATGAT
+
2222222222222222222222222222222222222222222222222222222222222222222222
@gi|110640213|ref|NC_008253.1|_31_476_0:0:0_0:0:0_1/1
*AAAAA*GGTTGGTGATTTTGGCGGGGGCAGAGAGGACGGTGGCCACCTGCCCCTGCCTGGCATTGCTTTCC
+
2222222222222222222222222222222222222222222222222222222222222222222222
@gi|110640213|ref|NC_008253.1|_210_743_2:0:0_1:1:0_2/1
*AAAAA*CCACCACCATCACCATTACCACAGGAAACGGTGCGGGCTGACGCGTACAGGAAACACCGAAAAAA
+
2222222222222222222222222222222222222222222222222222222222222222222222

I want to make sure that only the sequence at the beginning of the reads are modified and not throughout the read itself. The barcode sequence might be present within reads and I don't want to modify it.

Do you know any easy way to do this? Thanks!

fastq barcode
• 2,755 views • link
written by AP AP

2 answers

I assume that the * are not part of the sequence and are just there to highlight them :-) Then use awk:

zcat [in fasta file]  |awk '{if(NR%4==2){print "AAAAA"substr($0,5)}else{print $0}}' |gzip > [output fasta].gz
• 1 views • link
written by Gabriel R. Gabriel R.

Works like a charm! Thanks Gabriel. I was trying things with awk but I was not successful. This solves my issue. Also yes, the * are not part of the sequence :-)

• 1 views • link
written by AP AP

you are most welcome, mark the question as answered if you please :-)

• 1 views • link
written by Gabriel R. Gabriel R.

From Gabriel R:

zcat [in fasta file] |awk '{if(NR%4==2){print "AAAAA"substr($0,5)}else{print $0}}' |gzip > [output fasta].gz

• 0 views • link
written by AP AP

Log in to answer this question.

More posts like this