This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to merge the reads into single file

Hi all , I am working on RNA -seq Data analysis. I have reads for specific gene in a bam format which I was extracted using samtools command. That bam file contain 37 reads. I want merge these overlap reads and make into single file. Is there any tool available to do this ? Pls let me know ? (It is a pair end seq reads).

rna-seq

Why do you want to "merge" the reads? Are those 37 reads not already in a single bam file?

I am sorry if i didn't make my question clear. I have 37 reads which are mapping for specific gene. They are in single bam file. Since it is a bam file it has overlapping reads . So I want to merge these overlap reads and make into single fasta format sequence.

In other words, you'd like to make the "consensus sequence". Search this site or google for "BAM consensus sequence".

AGCGAATACACCGATACGCATCACTCACCAGCCATGCAGCTCGCGCAGGTGAACTACCACATCATCTCGGGGGATAGGGCTGAGAATTCCCATCACTACAG Read 1 GATACGCATCACTCACCAGCCAT*GCAGCTCGCGCAGGTGAACTACCACATCATCTCGGGGGATAGGGCTGAGAATTCCCATCACTACAGGTTCCTTTTGCT Read 2

CACCAGCCATGCAGCTCGCGCAGGTGAACTACCACATCATCTCGGGGGATAGGGCTGAGAATTCCCATCACTACAGGTTCCTTTTGCTCGTCTGCCAGCTG read 3 CACCAGCCATGCAGCTCGCGCAGGTGAACTACCACATCATCTCGGGGGATAGGGCTGAGAATTCCCATCACTACAGGTTCCTTTTGCTCGTCTGCCAGCTG read 4

I highlighted overlapping seq staring region

read 3 and 4 are same which means it is duplicate. If I combine read1 and read4 I will get whole seq upto read 4.Like wise I have 37 read seq some of them are duplicates .So is there tool to overlap

Read and do what I suggested above.

Those things I cant able to understand can u pls explain me more elobrately... how to merge the overlapping reads. I am having read file in BAM and it has 37 reads how to merge the overlapping region and make the sequence as like raw file or fasta file.

0 answers

No answers yet.

Log in to answer this question.