This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Multiple alignment format (MAF) to VCF

Hi,

I am wondering the best way to convert a Multiple Alignment Format file (MAF) generated with Mugsy (http://mugsy.sourceforge.net/) into a VCF format for downstream analysis?

I have looked through past posts and haven't found an answer. It seems that there was an earlier branch of Biopython which could do this but I don't think it is being updated.

If anyone has suggestions, that would be incredible! Thank you!

maf vcf
• 6,589 views • link
updated by Ram Ram • written by ksw • ksw

Did the past posts include this one: converting maf to vcf There is a script linked in that post that is still available to try.

• 0 views • link
written by GenoMax GenoMax

Thanks for your reply. Yes, I looked at the script you posted--it converts files in Mutation Annotation Format (another MAF file, specific to cancer genotyping, I think) to VCF format. The MAF format I am struggling with is Multiple Alignment Format.

• 0 views • link
written by ksw • ksw

Thanks, I'll look into the script you posted. The first lines of the MAF:

##maf version=1 scoring=mugsy a score=640492 label=1 mult=3 s B31.Chromosome 4603 638466 + 910724 AAAATCTCAGGAGAGGGATCAAATGGGGGATGCATAATTCATCCTTCAAGGGTAAGAGACCCAATTACTACTTTACTTAGTATCGTAAAATTATTAAAAATGAAAGAACTTTACCAAATATGGTGTAAATTGTCTAAAAACCACTATAAAGAAAAGTACGACTTAAAAGATATTTTAAATACAACAAATTTTTATAGTAATGTAATAGTATCATCCAAAAAAGCCAATTTAACAAATCTAAAAATAGAAAATCAAGAAATTTTAAAAAGCAATTATGAAAATCTATTGATTAAAGAGATAAAAAGTAATAAGTTATTTCAAGAATTATCAGTAGTTGATTATGAAATCATTAACTATGAAGGCAAAAGACAATCTAAGATTAGAACAGGAGATTCTTCGGGAGGATTAAAGGTATTGT

• 0 views • link
written by ksw • ksw

To update this thread: my issue was that I have called variants using short read data (i.e. generating BAM, then VCF files with respect to a reference genome). I am now interested in including outgroup (FASTA) sequences and need to call variants between the outgroups and the FASTA reference genome. The following tool takes a multiple FASTA alignment (for me, my reference genome and outgroup genomes) and can generate a VCF file:

[https://github.com/sanger-pathogens/snp-sites]

Thanks for your help!

• 0 views • link
written by ksw • ksw

0 answers

No answers yet.

Log in to answer this question.

More posts like this