Hi All, I am trying to use SOAPdenovo2 to assemble a large genome. I am completely new to this process. I have paired-end 125 bp fastq files. I have created my config file and I am using the following command to run the program:
cd "${PBS_O_WORKDIR}" bin=SOAPdenovo-63mer $bin sparse_pregraph -s config_BTM.txt -K 23 -z 1500000000 -R -o BTM 1>pregraph.log 2>pregraph.err $bin contig -g BTM -R 1>contig.log 2>contig.err
It seems to go through the pregraph stage successfully however it will not make the contig file. I get the following error message:
Version 2.04: released on July 13th, 2012 Compile Mar 8 2016 07:56:57
Contig
Parameters: contig -g BTM -R
There are 5601192 kmer(s) in vertex file. There are 25365036 edge(s) in edge file. Kmers sorted. 25365036 edge(s) input. 36550346 pre-arcs loaded. 442925084 markers overall. 501396034 markers loaded. 6336325 none-palindrome edge(s) swapped, 0 palindrome edge(s) processed. AGTCCATTGCTTTGCAATGGACT AGTCCATTGCTTTGCAATGGACT CCCACCTCATTGCTA CCCACCTCATTGCTA cmp_seq: err
I have no idea how to fix this. Any suggestions would be much appreciated!!!
Crae
1 answer
Hi!
I had the same problem, did you solve it? With subset of reads, no error was reported, so I thought it may out of memory. After tracing the memory usage, I exclude this possibility. Any suggestion would be grateful!
Following is my log:
41306549 none-palindrome edge(s) swapped, 0 palindrome edge(s) processed. AGGAATGGAAGGTCATAATTATA AGGAATGGAAGGTCATAATTATA TTGAAAATATAATTA TTGAAAATATAATTA cmp_seq: err
Log in to answer this question.
I don't know either, but try filtering out those two sequences from the initial dataset, and re-assemble the filtered dataset, see if it works.