This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Bowtie2 (ERR): bowtie2-align exited with value 1

Hi

I'm fairly new to next gen sequencing data analysis and am having some issues with Bowtie2 alignment. It was working fine up until a little while ago but has been giving the following error recently: (ERR): bowtie2-align exited with value 1. I get this error if I run my bowtie2 command:

$ bowtie2 -x /path/to/genome -U /path/to/fastq |samtools view -bhS - | samtools sort - aligned_file

(followed by an Abort! )and also when I just run bowtie2 ($ bowtie2) without any parameters. Because of the latter, I thought this was an installation problem, so I re-installed the program, but it still gives me the same error. Any thoughts on what the problem is and how to fix it?

Thanks!

chip-seq alignment bowtie2
• 34,301 views • link
updated by Ram Ram • written by s-root • s-root

Is that the entire error message?

• 0 views • link
written by jotan jotan

1 answer

It is not only the path to the indexed genome. You need also to provide with the prefix name of that indexed genome
• 0 views • link
written by Antonio R. Franco Antonio R. Franco

When I am giving this simple command 

bowtie2 -c e_coli GCGTGAGCTATGAGAAAGCGCCACGCTTCC

I am getting following error

(ERR): bowtie2-align exited with value. So there is something more that I am missing.

e_coli is prefix of index files and it is in the same directory.

• 0 views • link
updated by Ram Ram • written by longevityamit • longevityamit

Use this command instead

bowtie2 -x e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC
• 0 views • link
written by GenoMax GenoMax

Did not work. Now it is giving new problem:

bowtie2 -x e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC

Could not locate a Bowtie index corresponding to basename "e_coli" Error: Encountered internal Bowtie 2 exception (#1) Command: /home/amit/bin/bowtie2-align-s --wrapper basic-0 -x e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC (ERR): bowtie2-align exited with value 1

To cross check whether my directory contains e_coli prefix indexes

cat e_coli.

e_coli.1.ebwt e_coli.2.ebwt e_coli.3.ebwt e_coli.4.ebwt e_coli.rev.1.ebwt e_coli.rev.2.ebwt

  1. This did not resolve the problem of (ERR): bowtie2-align exited with value 1
  2. Usage of this brings new more error.
• 0 views • link
written by longevityamit • longevityamit

Since your local directory is not in your $PATH you need to specify

bowtie2 -x ./e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC

If you are not in the directory where the index files are then do (replace path_to with a real file path on your system)

bowtie2 -x /path_to/e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC
• 0 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this