This is a test version of Biostars. For the public version, visit https://www.biostars.org.
trimming the paired end reads with cutadapt

Hi,

I have paired end reads then I tried the below syntax to trim the universal adapters and quality trimming by cutadapt but I faced error always.

[izadi@lbox161 bowtie2-2.2.5]$ $CUT/cutadapt -q 35 -m 15 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o out.1.fastq -p out.2.fastq L6_1.fq L6_2.fq

cutadapt: error: no such option: -A

What is my fault please?

Thank you

rna-seq cutadapt software-error

What do you think "no such option: -A" means?

But I used the cutadapt manual syntax

cutadapt \
            -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
            -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT \
            -o trimmed.1.fastq.gz -p trimmed.2.fastq.gz \
            reads.1.fastq.gz reads.2.fastq.gz

for paired end I should use -A? What is wrong?

Maybe try to use the most recent version of cutadapt, the version I have installed (1.4.1) does not have -A argument option!

Either the documentation is wrong or they have a bug there. Or you're using a version that doesn't match the documentation.

2 answers

-A

There is no such option!

Cut adapt is having only the following options.

Adapter type                Command-line option
3' adapter                  -a ADAPTER
5' adapter                  -g ADAPTER
Anchored 3' adapter         -a ADAPTER$
Anchored 5' adapter         -g ^ADAPTER
5' or 3' (both possible)    -b ADAPTER

For more information with examples: http://cutadapt.readthedocs.org/en/stable/guide.html

Links:

I should change -A to -g then no error anymore

yes, for 5' adapter you have to use -g option.

Hello Ryan,

Yes, you are right. they have to update their documentation.

Log in to answer this question.