This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Can't tell the file format

Hi,

Can anyone help with a description of this file format? Obviously, it is neither fasta not fastq. It contains human RNA sequences.

hsa-miR-3670    AGAGCUCACAGCUGUCCUUCUCUA    hsa-mir-3670-1    40
hsa-miR-548z    CAAAAACCGCAAUUACUUUUGCA    hsa-mir-548z    54
hsa-miR-28-5p    AAGGAGCUCACAGUCUAUUGAG    hsa-mir-28    14
hsa-miR-28-3p    CACUAGAUUGUGAGCUCCUGGA    hsa-mir-28    54
hsa-miR-3119    UGGCUUUUAACUUUGAUGGC    hsa-mir-3119-2    9
hsa-miR-4314    CUCUGGGAAAUGGGACAG    hsa-mir-4314    11
hsa-miR-4741    CGGGCUGUCCGGAGGGGUCGGCU    hsa-mir-4741    59

Also, is it possible to convert a fasta file to this format?

Thanks!

sequencing

Just tell us what you want to convert to what if that's what you need. This may not be any format in particular.

It looks just like a plain whitespace (tab ?)-delimited text file.

It's the pwt?dt format, of course!

I'm sorry I didn't get the format you mentioned. which is it, pls?

I was making a joke by abbreviating Jean-Karim's response. Your data is white space separated, and unless you give us more details on the tool that output it, we cannot help you with it.

I cant tell the tool that out put that data. I am trying to run miRExpress and one of their sample files come in that format. I tried both fa and fq and it returned a segmentation fault. So I am looking to convert my fa or fq file to this format to avoid the seg fault.

I believe that unless you provide as piece of that fasta file and desired output file for the same file, no one here can really help you.

1 answer

Did you ever find an answer to this?

To add to the original poster's question:

The software miRExpress requires a file for mature known miRNA sequences that is formatted like the above. The first three columns are pretty straight-forward, but it's not clear what the 4th column is supposed to be.

Log in to answer this question.