Can't tell the file format
Hi,
Can anyone help with a description of this file format? Obviously, it is neither fasta not fastq. It contains human RNA sequences.
hsa-miR-3670 AGAGCUCACAGCUGUCCUUCUCUA hsa-mir-3670-1 40
hsa-miR-548z CAAAAACCGCAAUUACUUUUGCA hsa-mir-548z 54
hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG hsa-mir-28 14
hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA hsa-mir-28 54
hsa-miR-3119 UGGCUUUUAACUUUGAUGGC hsa-mir-3119-2 9
hsa-miR-4314 CUCUGGGAAAUGGGACAG hsa-mir-4314 11
hsa-miR-4741 CGGGCUGUCCGGAGGGGUCGGCU hsa-mir-4741 59
Also, is it possible to convert a fasta file to this format?
Thanks!
• 2,856 views
•
link
1 answer
Did you ever find an answer to this?
To add to the original poster's question:
The software miRExpress requires a file for mature known miRNA sequences that is formatted like the above. The first three columns are pretty straight-forward, but it's not clear what the 4th column is supposed to be.
• 0 views
•
link
Log in to answer this question.
Just tell us what you want to convert to what if that's what you need. This may not be any format in particular.
It looks just like a plain whitespace (tab ?)-delimited text file.
It's the pwt?dt format, of course!
I'm sorry I didn't get the format you mentioned. which is it, pls?
I was making a joke by abbreviating Jean-Karim's response. Your data is white space separated, and unless you give us more details on the tool that output it, we cannot help you with it.
I cant tell the tool that out put that data. I am trying to run miRExpress and one of their sample files come in that format. I tried both fa and fq and it returned a segmentation fault. So I am looking to convert my fa or fq file to this format to avoid the seg fault.
I believe that unless you provide as piece of that fasta file and desired output file for the same file, no one here can really help you.