I am trying to use MicNeSs for predicting SSR in NGS reads.
But I am getting some error.
The error is :
/programs/MicNeSsv1.1.py", line 1226, in <module>
MyBeautifullSequences_allindiv = ReadFasta2( file )
programs/MicNeSsv1.1.py", line 189, in ReadFasta2
indiv = elt_titre[1]
IndexError: list index out of range
Can anyone help me, to solve this?
I first tried with NGS raw reads which looks like this:
@NS500223:130:HHVYWBGXX:1:11101:19179:1103 1:N:0:GATGAATC+AGATCTCG
CTCAAGAAGGTCCAGAAGGAGCTCGCCGACGTGGTGGGGCTTCACCGCCGGGTCGAGGAGTCTGACTTTGAGAAATTGACCTACCTAAAGTGCGTGATCAAGGAGACACTCCGCCTCCACCCGCCGATCCCCCTCCTCCTCCACGAGACG
+
AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEAAAAEEAEAAEAAEEEEEEAEEEEE
Then I tried with scaffold fasta sequence.
With both the options I am getting same error.
The snippet you posted is of a FASTQ file, not FASTA. Is your scaffold file in the same format?
You seem to have an empty line between the header and the sequence. Could it be what's causing the error ? I think empty lines are not allowed in the middle of a fasta record so the sequence must immediately follow the header.
Log in to answer this question.
Barring a bug in the program, my guess is you have a badly formatted fasta file.