Hello again,

I need to calculate the CpG ratio within certain DNA sequences in order to correlate them with several properties and for different other reasons. Can somebody explain me how this is done for the following artificial example sequence?

ATGCGTGCAGTGATCGCGATTTA
  ^^^ ^^ ^ ^  ^^^^

As far as I understand, the GC-basepair ratio is the number of C's + G's divided by the length of the above sequence. In the example we have:

• Seq-length: 23
• Number of C's: 4
• Number of G's: 7

If the definition I found for GC content is correct, then in the above example the GC content would be:

• (4+7) / 23 = 47,83% (rounded value).

How is the CpG ratio defined? I am not searching for CpG islands.

Best regards