Batch replcement of fasta header
Hello
I'm trying to add some texts next to the existing fasta headers.
The fasta file contains 100 mRNA sequences, and additional information are saved in a separate file.
Input 1:
>NM_001133328
ggccattacggccggggctcccgctcgccctgaacctagtacctgcagccatg
Input 2:
NM_001133328 chr2b + 107030810 107070838 ATIC
Output;
>NM_001133328 chr2b + 107030810 107070838 ATIC
ggccattacggccggggctcccgctcgccctgaacctagtacctgcagccatg
I tried using 'awk' and 'while' commands, but couldn't figure it out.
Here's the command:
cat Input2 | while read line; do awk '/^>/ {$0=$0 "'$line'"}1' Input1 ; done | head
and the error message
awk: cmd. line:1: ^ unterminated string
awk: cmd. line:1: /^>/ {$0=$0 " NM_001168566
awk: cmd. line:1: ^ syntax error
Can anyone help me?
Thank you!
1 answer
awk can handle two file at once:
awk -v arrayStore -v fastaLine=1 'FNR==NR {arrayStore[NR] = $1;} FNR!=NR{if($1~/^>/){ print $0" "arrayStore[fastaLine]; fastaLine=fastaLine+1;}else{print}' Input2 Input1 > output
You can also use hash mapping which should be similar
Log in to answer this question.
More posts like this
-
why the syntax error comes when i use the same command in loop in bash linux
written by Priya •
-
To execute picard run: java -jar $EBROOTPICARD/picard.jar
written by Azhar Jameel •
-
Snakemake. Problem with awk
written by kamanovae •
-
Running STRUCTURE from command line
written by giulia.trauzzi •
-
Problems awking columns from map file
written by Nuthatch •
-
Getting error with awk when using parallel processing in bedtools
written by nastaran.esfahani •
-
Problem with FASTA filtering
written by Janey •
-
varscan copy number error
written by mittu1602
-
Making bed files from fasta
written by peri.tobias •
-
why different outputs with applying various extracting fasta sequences tool, which one correct!?
written by seta
